Open Access

Erratum to: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua

BMC Research Notes20114:456

DOI: 10.1186/1756-0500-4-456

Received: 24 October 2011

Accepted: 27 October 2011

Published: 27 October 2011

The original article was published in BMC Research Notes 2008 1:47

Following the publication of our article[1], an error in Table 2 was noted, the wrong accession number and primer sequences were stated for the EF1A assay.

The GenBank accession number was incorrectly stated as:

EX721840

Forward primer: CCCTGTGGAAGTGGCTGAAG

Reverse primer: CATCCAAGGGTCCGTATCTCTT

The correct GenBank accession number should be:

EX722124 Forward primer: CGGTATCCTCAAGCCCAACA Reverse primer: GTCAGAGACTCGTGGTGCATCT

We apologise for any inconvenience this may have caused.

Notes

Authors’ Affiliations

(1)
National Institute of Nutrition and Seafood Research

References

  1. Olsvik PA, Softeland L, Lie KK: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua. BMC Research Notes. 2008, 1: 47-10.1186/1756-0500-1-47.PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

© Olsvik et al; licensee BioMed Central Ltd. 2010

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement