Open Access

Establishment of a PCR analysis method for canine BRCA2

  • Yasunaga Yoshikawa1Email author,
  • Masami Morimatsu2,
  • Kazuhiko Ochiai3,
  • Kento Okuda1,
  • Takahiro Taoda4,
  • Seishiro Chikazawa5,
  • Asako Shimamura6,
  • Toshinori Omi3,
  • Makoto Bonkobara6,
  • Koichi Orino1 and
  • Kiyotaka Watanabe1
BMC Research Notes20125:173

DOI: 10.1186/1756-0500-5-173

Received: 2 February 2012

Accepted: 3 April 2012

Published: 3 April 2012

Abstract

Background

Mammary tumors are the most common tumor type in both human and canine females. In women, carriers of mutations in BRCA2, a tumor suppressor gene product, have a higher risk of breast cancer. Canine BRCA2 has also been suggested to have a relationship with mammary tumors. However, clearly deleterious BRCA2 mutations have not been identified in any canine mammary tumors, as appropriate methods to detect mutations or a consensus BRCA2 sequence have not been reported.

Findings

For amplification and sequencing of BRCA2, we designed 14 and 20 PCR primer sets corresponding to the BRCA2 open reading frame (ORF) and all 27 exons, respectively, including exon-intron boundaries of the canine BRCA2 regions, respectively. To define the consensus canine BRCA2 ORF sequence, we used established methods to sequence the full-length canine BRCA2 ORF sequence from two ovaries and a testis obtained from individual healthy mongrel dogs and partially sequence BRCA2 genomic sequences in 20-56 tumor-free dogs, each aged over 6 years. Subsequently, we compared these sequences and seven previously reported sequences, and defined the most common base sequences as the consensus canine BRCA2 ORF sequence. Moreover, we established a detection method for identifying splicing variants. Unexpectedly, we also identified novel splicing variants in normal testes during establishment of these methods.

Conclusions

The present analysis methods for determining the BRCA2 base sequence and for detecting BRCA2 splicing variants and the BRCA2 ORF consensus sequence are useful for better understanding the relationship between canine BRCA2 mutation status and cancer risk.

Findings

Mammary tumors are the most common tumor type in both human and canine females, constituting about half of all tumors in female dogs [14]. Furthermore, approximately half of canine mammary tumors are malignant [5, 6]. In humans, heritable breast cancers have been linked with mutations in the breast cancer susceptibility gene BRCA2. Genetic analysis, including detection of deleterious mutations and splicing variants, to identify BRCA2 mutation carriers is strongly advocated, as the lifetime risk of breast cancer is high (81-88%) for females carrying a BRCA2 mutation [7, 8].

In a recent study, it was suggested that the canine BRCA2 gene locus is associated with mammary tumors based on single nucleotide polymorphism analysis of an intronic marker [9, 10]. Consistent with this notion, we previously showed that loss of heterozygosity, which is one of the mechanisms of BRCA2 inactivation, was present in a mammary tumor [11]. Canine BRCA2 missense mutations have also been reported in mammary tumors [1113]. However, clearly deleterious mutations in the canine BRCA2 sequence have not been identified in mammary tumors due to the lack of appropriate methods to detect such mutations. Furthermore, a full-length consensus canine BRCA2 open reading frame (ORF) sequence has not been defined, as full-length canine BRCA2 has only been identified in a single sample [14].

Determination of the base sequence of BRCA2 in a tumor sample and of this sequence comparison with the BRCA2 consensus sequence is the most standard method for detecting mutations in tumor samples in humans. During the course of our present study, one study reported the mutation analysis of full-length of canine BRCA2, but they used many primer sets (about 50 sets) and amplified sequence only from genomic DNA [15]. To establish a more efficient mutation analysis method for cDNA and genomic DNA that requires fewer primer sets, we designed 14 and 20 primer sets in order to sequence the BRCA2 ORF and all 27 exons, respectively, including the exon-intron boundaries of the canine BRCA2 regions. All PCR targets were successfully amplified, and were sufficient to determine DNA base sequences (Figure 1A and 1B).
https://static-content.springer.com/image/art%3A10.1186%2F1756-0500-5-173/MediaObjects/13104_2012_Article_1472_Fig1_HTML.jpg
Figure 1

PCR products amplified by each primer set. (A) cDNA samples prepared from total RNA of each mammary gland were amplified. (B) Genomic DNA from each mammary gland was amplified. (C) Splicing variants of the cDNA from total RNA of the mammary gland and testis were amplified. Primer sets for each lane are shown in Table 1. The "M" indicates the molecular size marker (1-kbp DNA ladder; New England Biolabs). Arrowhead and "*" indicate novel BRCA2 transcript and non-specific PCR products, respectively.

Some splicing variants of tumor suppressor genes (e.g., BRCA2) in tumor tissue have been associated with tumorigenesis because these splicing variants often lead to frameshift mutations [16, 17]. Thus, we next designed five primer sets for detecting splicing variants from cDNA (Figure 1C). All PCR targets were successfully amplified, and the predicted sizes of PCR products were confirmed. During the establishment of this method, we unexpectedly identified splicing variants between exon 10 and exon 14 in normal testes (Figure 1C and 2). These transcripts skipped most of exon 11, leading to frameshift mutations (Figure 2).
https://static-content.springer.com/image/art%3A10.1186%2F1756-0500-5-173/MediaObjects/13104_2012_Article_1472_Fig2_HTML.jpg
Figure 2

Identification of splicing variants within exon 11 in normal testes. The splicing variants identified in normal testes lacked a large portion of exon 11. (A) To confirm the presence of a novel BRCA2 transcript, splicing variants of the cDNA from total RNA of the testes were amplified using nested PCR. (B-E) Electropherogram showing the direct sequencing data and overview of the novel BRCA2 transcript that lacked nucleotides 2390 to 6429 (B), 2390 to 6429 and 6588 to 6908 (C), 2390 to 3380, and 4649 to 6429 (D) and 2085 to 2321 and 2390 to 6429 (E) from Testis-1, -3, -4, and -5, respectively. The Testis-1 was the same sample used to generate the data in Figure 1C. Primer sets for each lane are shown in Table 1. The "M" indicates the molecular size marker (1-kbp DNA ladder). Arrowheads indicate novel BRCA2 transcripts.

To define the consensus canine BRCA2 ORF, we sequenced the full-length canine BRCA2 ORF in two ovaries and a testis obtained from individual healthy mongrel dogs using the method described here. We identified six single nucleotide variations (516 T > C, 1366 T > G, 2428 T > G, 2609A > C, 4481A > C and 8257 T > C) and two insertion/deletion polymorphisms (7126ins/delGTT and 10204ins/delAAA) (Accession numbers: AB622997, AB622998 and AB622999). None of these variations resulted in nonsense or frameshift mutations. To determine the most common base sequences and generate a consensus canine BRCA2 ORF sequence, we compared these three new sequences (six alleles) and the seven previously reported sequences (Accession numbers: AB043895.5, NC_006607.2, Z75664 and FJ464397-FJ464400) (Table 2). The four variations (516 T (103I), 2428 T (740 G), 4481A (1425 T), and 8257 T (2683I)) could be defined as consensus base sequences, but the other four variations (1366 T > G, 2609A > C (K801Q), 7126ins/delGTT, and 10204ins/delAAA) could not be defined as such because the frequencies between the major and minor alleles in each variation were nearly identical. We therefore sequenced these four variations in genomic DNA from 20-23 normal blood samples from tumor-free dogs aged over 6 years; the methods described here were used (Tables 3 and 4). We finally defined the most common base sequences as the consensus canine BRCA2 ORF sequence (Table 2). The 10204insAAA variation was consensus sequence in dogs, but in four miniature Dachshunds this variation was determined to be a minor variation (allele ratio; del:ins = 6:2, Table 4). To confirm the consensus sequence in miniature Dachshunds, we sequenced BRCA2 DNA from an additional 32 blood samples, and the assembled allele ratio was del:ins = 30:42 (Table 4).

We established a PCR analysis method for canine BRCA2 in order to determine the base sequence from cDNA and genomic DNA, and to detect splicing variants. We identified novel splicing variants in normal canine testes. The functions of these splicing variants were not assessed in this study; nevertheless, these results indicated that the established method was a useful tool for detecting splicing variants.

We also defined the consensus sequence using methods established and described here. During the definition of the consensus BRCA2 ORF, we identified three novel (516 T > C, 2428 T > G, and 8257 T > C) and three reported (1366 T > G, 2609A > C and 4481A > C) single nucleotide variations and two reported insertion/deletion polymorphisms (7126ins/delGTT and 10204ins/delAAA) (Accession numbers: AB622997, AB622998 and AB622999) [11, 12, 15, 18]. The variations 1366 T > G (C386W), 2609A > C (K801Q), 4481A > C (T1425P), and 10204ins/delAAA (M3332IV) are located in the histone acetyltransferase domain, the FANCG binding domain, BRC repeat 3, and nuclear localization signal 2, respectively [13, 1921]. The effects of these variations on BRCA2 function were not understood, with the exception of 10204insAAA; nuclear localization signal 2 harboring the 10204insAAA variation showed enhanced nuclear localization [13]. The other nonsynonymous variations were not located in previously known functional domains.

We identified four variations (1366 T > G, 2609A > C, 7126ins/delGTT, and 10204ins/delAAA), in which the allele frequency of minor variations in genomic DNA from normal blood samples was very high (28.5-37.5%). Such frequent variations in the BRCA2 gene have not been reported in other species. These highly frequent variations thus appear to be a canine BRCA2-specific feature, and should be considered when studying canine BRCA2. These four variations were found in the homozygous state in some blood samples from elderly tumor-free dogs. Homozygous mutations in BRCA2 are assumed to be embryonic-lethal mutations or responsible for Fanconi anemia, which is characterized by bone marrow failure, developmental abnormalities, and predisposition to cancer [22, 23]. Thus, these four variations were probably neutral variations, although the 10204insAAA variation is reportedly a candidate malignant mutation in dogs [11].

In this study, we established a PCR analysis method and defined the consensus sequence of BRCA2 ORF to identify canine BRCA2 mutations. Using these methods, we are now able to perform BRCA2 mutation analysis and search for abnormal BRCA2 splicing variants from mammary tumors in dogs, as is done in human cases.

Methods

Specimens

Two ovaries (from two mongrel dogs), six testes (from a mongrel dog and five Beagles), a mammary gland (from a female Beagle) and 56 blood samples (Table 4) from tumor-free dogs were kindly provided by Dr. Takashi Kubo and Dr. Go Honda. All experimental procedures were approved by and conducted in accordance with the Guidelines for Institutional Laboratory Animal Care and Use of the School of Veterinary Medicine at Kitasato University, Japan (Approval Number: 11-065).

Total RNA and genomic DNA extraction, and preparation of cDNA

Total RNA was isolated from ovaries, six testes, and one mammary gland, which each were stored in RNAlater solution (Life Technologies, Grand Island, NY), using a TRIzol and PureLink RNA micro kit (Life Technologies). First-strand cDNA was synthesized from 1-5 μg of total RNA using SuperScript III (Life Technologies). Genomic DNA samples were extracted using a Gentra Puregene tissue kit (Qiagen, Hilden, Germany).

PCR and sequencing

For PCR amplification of the full-length canine BRCA2 ORF from cDNA and all 27 exons from genomic DNA, we designed 14 and 20 primer sets, respectively (Table 1). We also designed five primer sets to detect splicing variants and a primer sets to confirm a novel BRCA2 transcript that lacked most of exon 11 using nested PCR (Table 1). Each reaction mixture contained 0.1 μL of first-strand cDNA reaction products or 10-50 ng of genomic DNA as a template, each forward and reverse primer at 300 nM, 200 μM dNTPs, 0.02 U of KOD FX DNA polymerase (Toyobo, Japan), and 1× PCR buffer, which was supplied with the enzyme, in a total volume of 10 μL. PCR included one cycle of 2 min at 94°C, followed by 35 cycles of 10 s at 98°C, 30 s at the optimal temperature shown in Table 1 the optimal time shown in Table 1 at 68°C, and a final extension step of 7 min at 68°C. PCR products were treated with shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA) and Exonuclease I (New England BioLabs, Beverley, MA) before sequencing, which was performed with the BigDye Terminator Cycle Sequencing kit Version 3.1 and a ABI PRISM 3100-Avant DNA sequencer (Life Technologies). Direct DNA sequencing was performed at least twice for each amplicon. When we attempted to define the consensus canine BRCA2 ORF sequence, two or three amplicons from each sample were sequenced. Because we detected only three electropherogram patterns among the PCR products with the insertion/deletion mutation sites, we were able to determine the heterozygous insertion/deletion mutations by direct sequencing (Additional file 1: Figure S1).
Table 1

Nucleotide base sequences of primers

 

Primer sets

Forward

Reverse

Annealing temperature

Elongation time

Lane Number

Expected sizes

For amplification of cDNA

1

5'-GCGGCACCTCGGAAGGC-3'

5'-CCCCAAACTTTGACTTTTAGC-3'

60°C

1 min

Figure 1 A 1

834 bp

 

2

5'-GATCGGTTTATCCCTTGTGGTC-3'

5'-CTTCAGGTTCTTTAAAGTTTGG-3'

60°C

1 min

Figure 1 A 2

865 bp

 

3

5'-CTGAAGGGATGTCCAATGC-3'

5'-ATATTTTATATGATTCTTTTCCTC-3'

56.1°C

1 min

Figure 1 A 3

850 bp

 

4

5'-CCAGTCTGTTAACTCCTAGC-3'

5'-GGATAATGTTCCTCAATATCTTTG-3'

60°C

1 min

Figure 1 A 4

826 bp

 

5

5'-ACAGCTTCTAATAAAGAGATAAA AC-3'

5'-GCCGGCATTTATTATTTTTC-3'

56.1°C

1 min

Fig. 1 A 5

850 bp

 

6

5'-GTTTCTCCTCAAGCAAATACAA-3'

5'-ATTTTTTACTTTGTCCAAAGATTCC-3'

60°C

1 min

Figure 1 A 6

873 bp

 

7

5'-CTGATCCTGCAGCAAAGACC-3'

5'-GAAAAACCAATGTTTTTTCTCTCTC-3'

59.2°C

1 min

Figure 1A 7

908 bp

 

8

5'-CATTCTAGTGAAGTGTATAATAA ATCAG-3'

5'-CTGTCCTAAATCCAGAGAAAGC-3'

50.8°C

1 min

Figure 1 A 8

919 bp

 

9

5'-AGTATCACTTAAAGATAATGAAG AAC-3'

5'-CTTTTAGGATGCCGTCTGG-3'

50°C

1 min

Figure 1 A 9

887 bp

 

10

5'-CCCCCAATTAAAAGAAACTTG-3'

5'-GCCAATTGTATTCCTTCTCC-3'

53.7°C

1 min

Figure 1 A 10

905 bp

 

11

5'-CCTCTGCATGTTCTCATAAAC-3'

5'-GGGTATGCTCTTTGAACAACTAC-3'

60°C

1 min

Figure 1 A 11

886 bp

 

12

5'-CATGGAGCAGAACTGGTAGG-3'

5'-GTGTAAGGTTTAATAATGTCTTCA-3'

50°C

1 min

Figure 1 A 12

1094 bp

 

13

5'-CCTATCCCAAGTTTATCAGCC-3'

5'-CAGACACAAGTTGATGTTCTCC-3'

60°C

1 min

Figure 1 A 13

959 bp

 

14

5'-GAAGGCATTTCAGCCACCACG-3'

5'-CAATCACACTAGAATCATAAAAAGG-3'

60°C

1 min

Figure 1 A 14

978 bp

For amplification of genomic DNA

exon 1-2

5'-GCCCCCTGCCCAGAACCC-3'

5'-CTTTTCAGCAAGCATGCACAGTTACG-3'

60°C

2 min

Figure 1 B 1

1193 bp

 

exon 3

5'-CTACAGTCAAAATGTCAAGCG-3'

5'-CACAATTAACAATAGATCTGGGAG-3'

60°C

1 min

Figure 1 B 2

430 bp

 

exon 4-7

5'-ATAAGAATAAAAACTTCCAGAGAATG-3'

5'-ATTATCTTTTCATATATTCTTTTTGTC-3'

60°C

2 min

Figure 1 B 3

1384 bp

 

exon 8-9

5'-GTAGTATATGTGACTTTTGATGTCTG-3'

5'-GGAAAAGCAATGTATTTTCTCTTT-3'

60°C

2 min

Figure 1 B 4

615 bp

 

exon 10

5'-CTTTAAATACTGCCTTATGGGCTA-3'

5'-GTCACCATCCCTAAAACTATATGC-3'

60°C

2 min

Figure 1 B 5

1311 bp

 

exon 11-a

5'-GTCACTTTGTGTCTTCATGC-3'

5'-GGATAATGTTCCTCAATATCTTTG-3'

56.4°C

2 min

Figure 1 B 6

1246 bp

 

exon 11-b(same as primer set 5)

5'-ACAGCTTCTAATAAAGAGATAAAAC-3'

5'-GCCGGCATTTATTATTTTTC-3'

56.4°C

1 min

Figure 1 B 7

850 bp

 

exon 11-c(same as primer set 6)

5'-GTTTCTCCTCAAGCAAATACAA-3'

5'-GATTTTTTACTTTGTCCAAAGATTCC-3'

60°C

1 min

Figure 1 B 8

873 bp

 

exon 11-d(same as primer set 7)

5'-CTGATCCTGCAGCAAAGACC-3'

5'-GAAAAACCAATGTTTTTTCTCTCTC-3'

59.2°C

1 min

Figure 1 B 9

908 bp

 

exon 11-e

5'-CATTCTAGTGAAGTGTATAATAAATCAG-3'

5'-ATTCCCCTAAACTATACATAAAAG-3'

56.4°C

2 min

Figure 1 B 10

1720 bp

 

exon 12

5'-CAATTCTTTAGTTTTAAAAAATGG GC-3

5'- GAAAAAGCTTAGAAAAAGAACTTAAAAAATAC-3'

59.2°C

1 min

Figure 1 B 11

275 bp

 

exon 13

5'- GTAAATGTTTATAATGTGTAATATACAGGC-3'

5'-CTGTACCTTCCCTACACTATATTAGTAG-3'

60°C

1 min

Figure 1 B 12

230 bp

 

exon 14-15

5'-CCAAACTTAAATATTTTCTCCTC-3'

5'-CAGGGATCCCAGTCTATTC-3'

60°C

2 min

Figure 1 B 13

1213 bp

 

exon 16

5'-GCAGCAAACCCTTGAATGTAG-3'

5'-GTCAGGTGAACCGTAATGTG-3'

60°C

1 min

Figure 1 B 14

552 bp

 

exon 17-8

5'- GGTCTTGTACAGTGTAGTGTTTG-3'

5'-GTTTTTAAGCAATGGAGCATC-3'

59.2°C

2 min

Figure 1 B 15

1258 bp

 

exon 19-20

5'- CCATCATGTTTAAATTGAAGTCTC-3'

5'-CAATTACAGAGGTTAAATCAGAAGCC-3'

59.2°C

2 min

Figure 1 B 16

739 bp

 

exon 21-24

5'-CTCGATATTTGATTCACCAGC-3'

5'-CAACAGTCCCTTCCTAACCC-3'

60°C

2 min

Figure 1 B 17

1739 bp

 

exon 25

5'- CAGTATCACTTTTTCTACATTTTG GTC-3'

5'-CCCAATTTTCACAGAAGCCAC-3'

59.2°C

1 min

Figure 1 B 18

471 bp

 

exon 26

5'-GGCTTCCATAGATGTTAGATG-3'

5'-GGACAACTTGGGATCATTTGC-3'

50.8°C

1 min

Figure 1 B 19

337 bp

 

exon 27

5'- GCTAAATTGCTGATGTTTTCTAC-3'

5'-CTGCTGAGTCCTCTAATAAGGC-3'

60°C

2 min

Figure 1 B 20

1437 bp

 

exon 25

5'- CAGTATCACTTTTTCTACATTTTGGTC-3'

5'-CCCAATTTTCACAGAAGCCAC-3'

59.2°C

1 min

Figure 1 B 18

471 bp

 

exon 26

5'-GGCTTCCATAGATGTTAGATG-3'

5'-GGACAACTTGGGATCATTTGC-3'

50.8°C

1 min

Figure 1 B 19

337 bp

 

exon 27

5'- GCTAAATTGCTGATGTTTTCTAC-3'

5'-CTGCTGAGTCCTCTAATAAGGC-3'

60°C

2 min

Figure 1 B 20

1437 bp

For detection of splicing variants

exon 1-11

5'-CGAATTTGTTAGCCGTCTCC-3'

5'-GGATCCTGAGATATTATTTTATTATTAG-3'

60°C

2.5 min

Figure 1 C 1

2118 bp

 

exon 10-14

5'-CTGAAGGGATGTCCAATGC-3'

5'-GAAATTTGGATTCTGTATTTCTTG-3'

58°C

6 min

Figure 1 C 2

5594 bp and 1554 bp

 

exon 11-18

5'-CTTCCTGTGAAAACAAATATAG-3'

5'-GCTGATCTTCTGCTTTTATC-3'

50.8°C

2 min

Figure 1 C 3

1417 bp

 

exon 15-25

5'-CCTCTGCATGTTCTCATAAAC-3'

5'-GTGTAAGGTTTAATAATGTCTTCA-3'

60°C

2 min

Figure 1 C 4

1759 bp

 

exon 24-27 (same as primer set 13)

5'-CCTATCCCAAGTTTATCAGCC-3'

5'-CAGACACAAGTTGATGTTCTCC-3'

60°C

2 min

Figure 1 C 5

959 bp

For nested PCR of the transcripts lacking most of exon 11

exon 10-13(1735-7280)

5'-GTTCTCAAATAATATGACTAATCCAAAC-3'

5'-GTTCCTCAGTTGTGCGAAAG-3'

58°C

6 min

Figure 2 A

5546 bp and 1506 bp, 1185 bp, 1674 bp or 1270 bp

For DNA sequence

cB2 seq1

5'-CAATAGAGGTGTTTTCTCCATC-3'

     
 

cB2 seq2

5'-GGATCCTGAGATATTATTTTATTATTAG-3'

    

5546 bp and 1506 bp, 1185 bp, 1674 bp or 1270 bp

 

cB2 seq3

5'-CCAGCTTTGTCTTTAACCAG-3'

     
 

cB2 seq4

5'-CTGTGTGACCACTTTCACTATC-3'

     
 

cB2 seq5

5'-CCCTCCTTCATAAACTGGC-3'

     
 

cB2 seq6

5'-CTTTCTGAGAGGCATGATCTG-3'

     
 

cB2 seq7

5'-GCATGGCAAGTGTCTGATTTAC-3'

     
 

cB2 seq8

5'-GTGAACAAACTTCACAACTTAACC-3'

     
 

cB2 seq9

5'-GCTGATCTTCTGCTTTTATC-3'

     
 

cB2 seq10

5'-GGTATGTTTTACAATGATGC-3'

     
 

cB2 ex14 R (exon)

5'-CTAAAGGTTCTTTTTCATTCTTTG-3'

     
 

cB2 ex15 F

5'- GCTTTTTAAATGTTACATGGAGG-3'

     
 

cB2 ex17 R

5'-GTACCAGTCAGGGATGTGAG-3'

     
 

cB2 ex18 F (exon)

5'-ATATGATGTGGAAATTGATAAAA G-3'

     
 

cB2 ex22F

5'-CTTTTTAAAGGGATTCATTTACAG TGG-3'

     
 

cB2 ex23 F (exon)

5'-CCATCACCAGATTTATATTCCC-3'

     
 

cB2 ex26 R (exon)

5'-CAGAAATTTATTTCCTATGCC-3'

     
 

cB2 ex23 F (exon)

5'-CCATCACCAGATTTATATTCCC-3'

     
 

cB2 ex26 R (exon)

5'-CAGAAATTTATTTCCTATGCC-3'

     
Table 2

Comparison between our sequences from the canine BRCA2 open reading frame with registered sequences

Nucletide locationa

516 T > C

1366 T > G

2428 T > G

2609A > C

4481A > C

7126delGTT

8257 T > C

10204insAAA

Amino acid

I103T

C386W

Silent

K801Q

T1425P

2307delL

Silent

M3332IK

Coding exon

3

10

11

11

11

12

18

27

Novel or reported variation

Novel

Reported

Novel

Reported

Reported

Reported

Novel

Reported

Present resequencing resultsb

   Full length

Ovary 1

T/C

G/G

T/G

C/A

A/C

ins/del

T/C

ins/ins

 

Ovary 2

T/T

G/G

T/T

C/C

A/A

del/del

T/T

ins/ins

 

Testis

T/T

G/G

T/T

C/C

A/A

del/del

T/T

ins/ins

   Partial

Genome

N. D.

T:G =

N. D.

A:C =

N. D.

ins:del =

N. D.

del:ins =

   

12:30

 

29:15

 

25:15

 

17:29

Registered sequencesc

   Ochiai et al.

Testis

T

T

T

A

A

ins

T

del

   Genome project

Genome

T

T

T

A

A

ins

T

del

   Bignell et al.

Genome

-

-

T

A

A

-

-

-

   Hsu et al.

Mammary gl.

-

-

T

A

A

-

-

-

Total allele frequency

T:C =

T:G =

T:G =

A:C =

A:C =

ins:del =

T:C =

del:ins =

  

7:1

14:36

12:1

37:20

12:1

28:20

7:1

19:35

Consensus sequence

516 T

1366 G

2428 T

2609A

4481A

7126insGTT

8257 T

10204insAAA

 

(103I)

(386 W)

(740 G)

(801 K)

(1425 T)

(2307insL)

(2638I)

(3332IK)

N. D., not determined.

aNucleotide and amino acid location is based on AB043895.5

bFull-length sequence was determined by cDNA sequencing (Accession number; AB622997, AB622998 and AB622999). When frequencies of major and minor alleles were nearly equal or were inconsistent with reported sequences, alleles were further analyzed by partial sequencing of blood genome DNA from 20-23 dogs (Table 3 and 4).

cSequence from one dog was regarded as one allele because allele type analyses have not been described in these reports. The study by Hsu et al. examined three dogs, while others studied only one dog. Accession numbers for sequences reported by Ochiai et al., the Genome Project, Bignell et al. and Hsu et al. are AB043895.5, NC_006607.2, Z75664 and FJ464397-FJ464400, respectively.

Table 3

Genotype frequency of four variations in normal blood samples

Nucletide locationa

1366 T > G

2609A > C

7126delGTT

10204insAAA

Amino acida

C386W

K801Q

2307delL

M3332IK

Coding exon

10

11

12

27

Genotype frequency

1366 T homozygosity

2/21

2609A homozygosity

10/22

insGTT homozygosity

9/20

delAAA homozygosity

5/23

 

1366 G homozygosity

11/21

2609 C homozygosity

3/22

delGTT homozygosity

4/20

insAAA homozygosity

11/23

 

Heterozygosity

8/21

Heterozygosity

9/22

Heterozygosity

7/20

Heterozygosity

7/23

aNucleotide and amino acid locations are based on AB043895.5

Table 4

Information of blood samples and allele type of the four frequently found variations

Sample name

Sex

Year

Breed

Nucletide locationa

    

1366 T > G

2609A > C

7126delGTT

10204insAAA

K-1

Male

7

Beagle

G/G

C/C

del/del

ins/ins

K-2

Male

9

Labrador retriever

G/G

A/C

ins/del

ins/ins

K-3

Female

9

Mongrel dog

G/T

A/A

ins/ins

del/ins

K-4

Male

10

Bichon Frise

G/T

A/A

ins/ins

del/ins

K-5

Female

12

Pomeranian

G/G

A/A

ins/ins

ins/ins

K-6

Female

12

Puli

G/T

A/A

ins/ins

del/del

K-7

Female

6

Puli

G/T

A/A

ins/ins

del/ins

K-8

Male

10

Miniature Dachshund

G/T

A/C

ins/del

del/ins

K-9

Male

8

Miniature Dachshund

G/T

A/C

ins/del

del/del

K-10

Male

8

Miniature Dachshund

T/T

A/A

ins/ins

del/del

K-11

Female

7

Papillon

G/G

C/C

del/del

ins/ins

K-12

Female

7

Mongrel dog

G/G

A/A

ins/ins

-

K-13

Female

12

Miniature Pinscher

T/T

A/A

ins/ins

del/del

K-14

Male

14

mongrel dog

G/G

A/C

ins/del

ins/ins

K-15

Male

14

mongrel dog

G/G

A/A

-

ins/ins

K-17

Female

7

Papillon

-

C/C

-

ins/ins

K-19

Female

9

Mongrel dog

G/G

A/A

ins/ins

del/ins

K-20

Male

10

Mongrel dog

G/T

A/C

ins/del

ins/ins

K-21

Female

7

Mongrel dog

G/G

A/C

-

ins/ins

K-23

Male

10

Mongrel dog

G/G

A/C

-

del/ins

K-26

Male

15

Mongrel dog

G/G

A/C

ins/del

ins/ins

K-27

Female

9

Miniature Dachshund

-

A/C

ins/del

del/ins

K-28

Male

6

Cavalier King Charles Spaniel

G/T

-

del/del

ins/ins

K-29

Male

12

Mongrel dog

-

-

del/del

del/del

MD-1

Male

10

Miniature Dachshund

-

-

-

del/del

MD-2

Male

7

Miniature Dachshund

-

-

-

del/del

MD-3

Male

6

Miniature Dachshund

-

-

-

ins/ins

MD-4

Male

10

Miniature Dachshund

-

-

-

del/ins

MD-5

Male

12

Miniature Dachshund

-

-

-

del/ins

MD-6

Female

7

Miniature Dachshund

-

-

-

del/ins

MD-7

Male

12

Miniature Dachshund

-

-

-

del/del

MD-8

Male

11

Miniature Dachshund

-

-

-

del/ins

MD-9

Female

9

Miniature Dachshund

-

-

-

del/ins

MD-10

Male

9

Miniature Dachshund

-

-

-

ins/ins

MD-11

Male

10

Miniature Dachshund

-

-

-

del/ins

MD-12

Female

14

Miniature Dachshund

-

-

-

del/ins

MD-13

Male

9

Miniature Dachshund

-

-

-

ins/ins

MD-14

Male

6

Miniature Dachshund

-

-

-

ins/ins

MD-15

Male

6

Miniature Dachshund

-

-

-

ins/ins

MD-16

Female

7

Miniature Dachshund

-

-

-

del/ins

MD-17

Male

8

Miniature Dachshund

-

-

-

del/del

MD-18

Male

12

Miniature Dachshund

-

-

-

del/ins

MD-19

Male

10

Miniature Dachshund

-

-

-

ins/ins

MD-20

Male

6

Miniature Dachshund

-

-

-

ins/ins

MD-21

Female

6

Miniature Dachshund

-

-

-

del/ins

MD-22

Male

10

Miniature Dachshund

-

-

-

ins/ins

MD-23

Female

10

Miniature Dachshund

-

-

-

del/ins

MD-24

Female

7

Miniature Dachshund

-

-

-

del/ins

MD-25

Female

7

Miniature Dachshund

-

-

-

ins/ins

MD-26

Male

8

Miniature Dachshund

-

-

-

ins/ins

MD-27

Female

9

Miniature Dachshund

-

-

-

del/ins

MD-28

Male

9

Miniature Dachshund

-

-

-

ins/ins

MD-29

Male

8

Miniature Dachshund

-

-

-

del/ins

MD-30

Male

8

Miniature Dachshund

-

-

-

del/ins

MD-31

Male

9

Miniature Dachshund

-

-

-

ins/ins

MD-32

Female

12

Miniature Dachshund

-

-

-

del/ins

aNucleotide and amino acid locations are based on AB043895.5

"-" indicates not determined.

Declarations

Acknowledgements

This work was supported in part by a Kitasato University Research Grant for Young Researchers and a Grant for the Encouragement of Young Scientists from the School of Veterinary Medicine, Kitasato University, Grant-in-Aid for Young Scientists (B) (No. 23780326 and No. 22791476) and for Scientific Research (C) (No. 23580399) from Japan Society for the Promotion of Science.

Authors’ Affiliations

(1)
Laboratory of Veterinary Biochemistry, School of Veterinary Medicine, Kitasato University
(2)
Division of Disease Model Innovation, Institute for Genetic Medicine, Hokkaido University
(3)
Department of Basic Science, School of Veterinary Nursing and Technology, Nippon Veterinary and Life Science University
(4)
Department of Small Animal Surgery 2, School of Veterinary Medicine, Kitasato University
(5)
Department of Small Animal Internal Medicine 2, School of Veterinary Medicine, Kitasato University
(6)
Department of Veterinary Science, School of Veterinary Medicine, Nippon Veterinary and Life Science University

References

  1. DeSantis C, Siegel R, Bandi P, Jemal A: Breast cancer statistics, 2011. CA Cancer J Clin. 2011, 61 (6): 409-418.PubMedView ArticleGoogle Scholar
  2. Egenvall A, Bonnett BN, Ohagen P, Olson P, Hedhammar A, von Euler H: Incidence of and survival after mammary tumors in a population of over 80,000 insured female dogs in Sweden from 1995 to 2002. Prev Vet Med. 2005, 69 (1-2): 109-127. 10.1016/j.prevetmed.2005.01.014.PubMedView ArticleGoogle Scholar
  3. Moe L: Population-based incidence of mammary tumours in some dog breeds. J Reprod Fertil Suppl. 2001, 57: 439-443.PubMedGoogle Scholar
  4. Moulton JE, Rosenblatt LS, Goldman M: Mammary tumors in a colony of beagle dogs. Vet Pathol. 1986, 23 (6): 741-749.PubMedGoogle Scholar
  5. Gilbertson SR, Kurzman ID, Zachrau RE, Hurvitz AI, Black MM: Canine mammary epithelial neoplasms: biologic implications of morphologic characteristics assessed in 232 dogs. Vet Pathol. 1983, 20 (2): 127-142.PubMedView ArticleGoogle Scholar
  6. Moulton JE, Taylor DO, Dorn CR, Andersen AC: Canine mammary tumors. Pathol Vet. 1970, 7 (4): 289-320. 10.1177/030098587000700401.PubMedView ArticleGoogle Scholar
  7. Evans DG, Shenton A, Woodward E, Lalloo F, Howell A, Maher ER: Penetrance estimates for BRCA1 and BRCA2 based on genetic testing in a Clinical Cancer Genetics service setting: risks of breast/ovarian cancer quoted should reflect the cancer burden in the family. BMC Cancer. 2008, 8: 155-10.1186/1471-2407-8-155.PubMedPubMed CentralView ArticleGoogle Scholar
  8. King M-C, Marks JH, Mandell JB, Group NYBCS: Breast and ovarian cancer risks due to inherited mutations in BRCA1 and BRCA2. Science. 2003, 302 (5645): 643-646. 10.1126/science.1088759.PubMedView ArticleGoogle Scholar
  9. Rivera P, Melin M, Biagi T, Fall T, Haggstrom J, Lindblad-Toh K, von Euler H: Mammary tumor development in dogs is associated with BRCA1 and BRCA2. Cancer Res. 2009, 69 (22): 8770-8774. 10.1158/0008-5472.CAN-09-1725.PubMedView ArticleGoogle Scholar
  10. Rivera P, von Euler H: Molecular biological aspects on canine and human mammary tumors. Vet Pathol. 2011, 48 (1): 132-146. 10.1177/0300985810387939.PubMedView ArticleGoogle Scholar
  11. Yoshikawa Y, Morimatsu M, Ochiai K, Nagano M, Tomioka Y, Sasaki N, Hashizume K, Iwanaga T: Novel variations and loss of heterozygosity of BRCA2 identified in a dog with mammary tumors. Am J Vet Res. 2008, 69 (10): 1323-1328. 10.2460/ajvr.69.10.1323.PubMedView ArticleGoogle Scholar
  12. Hsu W-L, Huang Y-H, Chang T-J, Wong M-L, Chang S-C: Single nucleotide variation in exon 11 of canine BRCA2 in healthy and cancerous mammary tissue. Vet J. 2010, 184 (3): 351-356. 10.1016/j.tvjl.2009.03.022.PubMedView ArticleGoogle Scholar
  13. Yoshikawa Y, Morimatsu M, Ochiai K, Nagano M, Yamane Y, Tomizawa N, Sasaki N, Hashizume K: Insertion/deletion polymorphism in the BRCA2 nuclear localization signal. Biomed Res. 2005, 26 (3): 109-116. 10.2220/biomedres.26.109.PubMedView ArticleGoogle Scholar
  14. Ochiai K, Morimatsu M, Tomizawa N, Syuto B: Cloning and sequencing full length of canine Brca2 and Rad51 cDNA. J Vet Med Sci. 2001, 63 (10): 1103-1108. 10.1292/jvms.63.1103.PubMedView ArticleGoogle Scholar
  15. Borge KS, Børresen-Dale AL, Lingaas F: Identification of genetic variation in 11 candidate genes of canine mammary tumour. Vet Comp Oncol. 2011, 9 (4): 241-250. 10.1111/j.1476-5829.2010.00250.x.PubMedView ArticleGoogle Scholar
  16. Sugiura T, Matsuyama S, Akiyosi H, Takenaka S, Yamate J, Kuwamura M, Aoki M, Shimada T, Ohashi F, Kubo K: Expression patterns of the BRCA1 splicing variants in canine normal tissues and mammary gland tumors. J Vet Med Sci. 2007, 69 (6): 587-592. 10.1292/jvms.69.587.PubMedView ArticleGoogle Scholar
  17. Walker LC, Whiley PJ, Couch FJ, Farrugia DJ, Healey S, Eccles DM, Lin F, Butler SA, Goff SA, Thompson BA, et al: Detection of splicing aberrations caused by BRCA1 and BRCA2 sequence variants encoding missense substitutions: implications for prediction of pathogenicity. Hum Mutat. 2010, 31 (6): E1484-1505. 10.1002/humu.21267.PubMedPubMed CentralView ArticleGoogle Scholar
  18. Yoshikawa Y, Morimatsu M, Ochiai K, Nagano M, Yamane Y, Tomizawa N, Sasaki N, Hashizume K: Analysis of genetic variations in the exon 27 region of the canine BRCA2 locus. J Vet Med Sci. 2005, 67 (10): 1013-1017. 10.1292/jvms.67.1013.PubMedView ArticleGoogle Scholar
  19. Hussain S, Witt E, Huber PAJ, Medhurst AL, Ashworth A, Mathew CG: Direct interaction of the Fanconi anaemia protein FANCG with BRCA2/FANCD1. Hum Mol Genet. 2003, 12 (19): 2503-2510. 10.1093/hmg/ddg266.PubMedView ArticleGoogle Scholar
  20. Ochiai K, Yoshikawa Y, Oonuma T, Tomioka Y, Hashizume K, Morimatsu M: Interactions between canine RAD51 and full length or truncated BRCA2 BRC repeats. Vet J. 2011, 190 (2): 293-295. 10.1016/j.tvjl.2010.11.001.PubMedView ArticleGoogle Scholar
  21. Siddique H, Zou JP, Rao VN, Reddy ES: The BRCA2 is a histone acetyltransferase. Oncogene. 1998, 16 (17): 2283-2285. 10.1038/sj.onc.1202003.PubMedView ArticleGoogle Scholar
  22. Howlett NG, Taniguchi T, Olson S, Cox B, Waisfisz Q, De Die-Smulders C, Persky N, Grompe M, Joenje H, Pals G, et al: Biallelic inactivation of BRCA2 in Fanconi anemia. Science. 2002, 297 (5581): 606-609. 10.1126/science.1073834.PubMedView ArticleGoogle Scholar
  23. Sharan SK, Morimatsu M, Albrecht U, Lim DS, Regel E, Dinh C, Sands A, Eichele G, Hasty P, Bradley A: Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature. 1997, 386 (6627): 804-810. 10.1038/386804a0.PubMedView ArticleGoogle Scholar

Copyright

© Yoshikawa et al; licensee BioMed Central Ltd. 2010

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement