Open Access

Analysis of T-DNA alleles of flavonoid biosynthesis genes in Arabidopsis ecotype Columbia

  • Peter A Bowerman1, 3,
  • Melissa V Ramirez1, 4,
  • Michelle B Price1, 5,
  • Richard F Helm2 and
  • Brenda SJ Winkel1Email author
BMC Research Notes20125:485

DOI: 10.1186/1756-0500-5-485

Received: 27 April 2012

Accepted: 23 August 2012

Published: 4 September 2012

Abstract

Background

The flavonoid pathway is a long-standing and important tool for plant genetics, biochemistry, and molecular biology. Numerous flavonoid mutants have been identified in Arabidopsis over the past several decades in a variety of ecotypes. Here we present an analysis of Arabidopsis lines of ecotype Columbia carrying T-DNA insertions in genes encoding enzymes of the central flavonoid pathway. We also provide a comprehensive summary of various mutant alleles for these structural genes that have been described in the literature to date in a wide variety of ecotypes.

Findings

The confirmed knockout lines present easily-scorable phenotypes due to altered pigmentation of the seed coat (or testa). Knockouts for seven alleles for six flavonoid biosynthetic genes were confirmed by PCR and characterized by UPLC for altered flavonol content.

Conclusion

Seven mutant lines for six genes of the central flavonoid pathway were characterized in ecotype, Columbia. These lines represent a useful resource for integrating biochemical and physiological studies with genomic, transcriptomic, and proteomic data, much of which has been, and continues to be, generated in the Columbia background.

Keywords

Arabidopsis Ecotype Insertional inactivation lines Flavonoid Transparent testa

Background

Flavonoids are a group of specialized plant metabolites that play critical roles in plant reproduction, defense from abiotic and biotic stress and are of growing interest as health-promoting compounds in human and animal diets [13]. As pigments, they have also figured into numerous seminal biological discoveries including Mendel’s elucidation of the laws of genetics, McClintock’s discovery of mobile genetic elements, and more recently the phenomenon of cosuppression, or RNA interference, in Petunia hybrida (reviewed in [4, 5]). The flavonoid pathway continues to serve as an important experimental system in a variety of plant species, with studies ranging from understanding complex transcriptional control to biochemical structure-function relationships, intra- and intercellular transport, and the subcellular organization of pathways as multi-enzyme complexes [69]. Still, many questions remain about the specific biological targets of flavonoids in plants and animals [1, 10], while engineering the production of specific flavonoids in plants and microorganisms is still far from straight-forward [11, 12].

Mutations within genes in the flavonoid biosynthetic pathway of Arabidopsis were described as early as 1971, easily identified by the transparent testa (tt) phenotype of the mutant seed coat [13] (Figure 1 and Table 1). Large-scale mutant screens carried out by Maarten Koornneef, initially aimed at characterizing the effects of fast-neutron and X-rays, identified many more flavonoid biosynthetic and regulatory genes [14, 15]. Several other mutants were subsequently identified by Koornneef and others, almost all which have now been cloned and characterized [2]. While this represented an extremely useful toolset, these EMS and fast neutron induced mutations were isolated in a variety of ecotypes, primarily Landsberg but also several others, complicating the analysis of differences between mutants. While differences between ecotypes are sometimes minimal, morphological differences between ecotypes can be easily identified by eye, and research indicates that there are important differences between these backgrounds [1618]. Here we describe the confirmation and preliminary characterization of mutant alleles for genes encoding flavonoid enzymes in Arabidopsis ecotype Columbia-0 (Col-0) that are available as part of the SALK collection of T-DNA insertion lines [19]. These lines represent a useful set of tools for analyzing the organization of flavonoid biosynthetic enzymes and their end products, as well the cellular, physiological and ecological roles of flavonoids. We also present a compilation of mutant alleles for flavonoid structural gene that have been described in the literature to date in a variety of different ecotypes.
https://static-content.springer.com/image/art%3A10.1186%2F1756-0500-5-485/MediaObjects/13104_2012_Article_1865_Fig1_HTML.jpg
Figure 1

Seed coat color phenotype of confirmed homozygous T-DNA lines with insertions disrupting genes involved in flavonoid biosynthesis. From top center, clockwise seeds are: Col-0 WT, tt4-13, tt5-3, tt5-2, tt6-3, tt7-5, tt11-11, and ban-4.

Table 1

Summary of enzyme-encoding tt alleles described to date

Gene

Allele1

Line number2

Ecotype3

Mutagen4

First described

chalcone synthase (CHS)at5g13930

tt4-1

85

Ler

EMS

[14, 20]

tt4-2

2YY6

Col

EMS

[2123]

tt4-3

C1

Col

Carbon ions

[24]

tt4-4

C2

Col

Carbon ions

tt4-5

UV01

Ler

γ radiation

[25]

tt4-6

UV25

Ler

EMS

tt4-7

UV113

Ler

γ radiation

tt4-8

UV118a

Ler

γ radiation

tt4-9

38G1R

Ler

γ radiation

tt4-10

 

Est-1

EMS

[26]

tt4-11

DFW34

Ws-2

T-DNA

[27]

tt4-12

CS429127 / GK-304D03

Col

T-DNA

[28]

tt4-13

SALK_020583 5

Col-0

T-DNA

[29, 30]

tt4-14 through 21

  

zinc finger nucleases

[31]

chalcone isomerase (CHI)at3g55120

tt5-1

86

 

EMS

[14]

tt5-2

CS300857/ GK-176H03

Col

T-DNA

[28, 30]; this report

tt5-3

SALK_034145

Col-0

T-DNA

This report

flavanone 3-hydroxylase (F3H)at3g51240

tt6-1

87

Ler

EMS

[14, 32]

f3h-2::En

 

Col

Transposon

[32]

f3h-3::En

 

Col

Transposon

f3h-4f

 

Col

Transposon

f3h-5f

 

Col

Transposon

tt6-2

CS427992 / GK-292E08

Col-0

T-DNA

[28]

tt6-3

SALK_113904 5

Col-0

T-DNA

[33]

tt6-4

SALK_023664

Col-0

T-DNA

Leaky allele – unpublished results

flavonoid 3'-hydroxylase (F3'H)at5g07990

tt7-1

88

Ler

EMS

[14, 34]

tt7-2

 

Col-7

T-DNA

[35]

tt7-3

CS433473 / GK-349F05

Col-0

T-DNA

[28, 30]

tt7-4

DJI11

Ws-2

T-DNA

[27]

tt7-5

SALK_053394

Col-0

T-DNA

[36]

dihydroflavonol 4-reductase (DFR) at5g42800

tt3-1

84

Ler

EMS

[37]

tt3-2

CS428258 / GK-295C10

Col-0

T-DNA

[28]

tt3-3

 

Est-1

fast neutrons

[26]

 

GK-212G01

Col-0

T-DNA

Some segregants have pale brown seeds, none yellow

 

SALK_099848

Col-0

T-DNA

Does not have phenotype

anthocyanidin synthase (ANS/LDOX)at4g22880

tt11-1

   

Debeaujon and Koornneef, unpublished

tt11-2

 

Ler

EMS

[38]

tds4-1

 

Ws-4

T-DNA but not tagged (INRA)

[35]

tds4-2

SALK_028793

Col-0

T-DNA

[39]

tds4-3

CSHL GT9767

Ler

Gene trap

tt17

 

Est-1

Fast neutrons

[26]

tt18-1

AB084467

Col

Carbon ions

[40]

tt18-2

AB084468

Col

Carbon ions

tt18-3

 

Col

Carbon ions

tt11-11 (tds4-4)

SALK_073183

Col-0

T-DNA

[39]; this report.

anthocyanidin reductase (ANR/BAN) at1g61720

ban-1

 

Ws-2

T-DNA

[41]

ban-2

F36

En-1

unknown

[42]

ban-3

F52

En-1

unknown

ban-4

SALK_040250 5

Col-0

T-DNA

This report

flavonol synthase 1 (FLS1)at5g08640

fls1-1

fls-1::En

Col

Transposon

[32, 43]

fls-2f

 

Col

Transposon

[32]

fls-3f

 

Col

Transposon

fls-4d

 

Col

Transposon

fls1-2

RIKEN PST16145

No-0

T-DNA

[44]

fls1-3

INRA FLAG_533E06 (AJ588535/EGT283)

Ws

T-DNA

[45]

 

SALK_076420

Col-0

T-DNA

Recessive embryo lethal potentially due to disruption of adjacent divergently-transcribed gene [45]

FLS2at5g63580

fls2-1

SALK_023235

Col-0

T-DNA

[45]

fls2-2

GK-429B10

Col-0

T-DNA

[44]

FLS3at5g63590

fls3-1

SALK_050041

Col-0

T-DNA

[44, 45]

FLS4at5g63595

fls4-1

SALK_002309

Col-0

T-DNA

FLS5at5g63600

fls5-1

CS430396 / GK-317E12

Col-0

T-DNA

FLS6at5g43935

fls6-1

SALK_0038795

Col-0

T-DNA

 

1 Alleles in bold are described in the current study.

2 GK = GABI-Kat.

3Standard ecotype abbreviations, as follows: Landsberg erecta (Ler); Columbia accession number 0 (Col-0) or accession unknown (Col), ; Enkheim (En-1); Estland (Est-1); Wassilewskija (Ws-2).

4 ethyl methanesulfonate (EMS).

5 independently-derived homozygote already available at ABRC.

Findings

Confirmation of homozygous tt alleles

T-DNA insertion lines in ecotype Col-0 were obtained from the Arabidopsis Biological Resource Center (ABRC, Columbus, OH) for genes encoding six of the eight enzymes of the central flavonoid pathway: chalcone synthase (CHS, SALK_020583), chalcone isomerase (CHI, SALK_034145 and CS300857 from the GABI-Kat project), flavanone 3-hydroxylase (F3H, SALK_113904), flavonoid 3-hydroxylase (F3H, SALK_053394), anthocyanidin synthase (ANS, SALK_073183), and anthocyanidin reductase (ANR, SALK_040250). These lines were assigned allele numbers based on the previously-published alleles for each locus (Table 1). Note that a mutant allele for dihydroflavonol reductase (DFR) was recently identified in the Col-0 background that was not included in this study; no stable mutant allele has yet been identified in this ecotype for flavonol synthase 1 (FLS1).

DNA was isolated from leaves of each T-DNA line to screen for lines homozygous for each insertion. The ability to produce a PCR product from Col-0 wild-type plants using primers that span the T-DNA insertion site (Figure 2) was used to identify the presence of an intact gene. The absence of an amplicon using the same primers for T-DNA lines indicates that the insertion is present, while products generated using one T-DNA-specific and one gene-specific primer indicate the presence of a T-DNA insertion in the gene of interest. The results illustrated in Figure 3 identify each line as containing a homozygous T-DNA insertion in the gene of interest, most within the respective open reading frames, with the exception of alleles of CHI (SALK_034145) and FLSI (AJ588535), which contain insertions within the promoters, and CHI (CS300857) and ANR (SALK_040250) with insertion in introns. It should be noted that these lines may contain additional T-DNA insertions at other sites of the genome; it has not yet been determined whether that is the case for any of the lines described here.
https://static-content.springer.com/image/art%3A10.1186%2F1756-0500-5-485/MediaObjects/13104_2012_Article_1865_Fig2_HTML.jpg
Figure 2

Schematic of homozygous T-DNA insertion lines. Boxes indicate exons, solid lines indicate introns and 5 leader sequence, and dashed lines indicate genomic sequence. Insertion sites are indicated by black triangles. The arrows above the insertion indicate the direction of the T-DNA left-border primer sequence used for mapping the insertion sites. The fls1 line is described in Owens et al. [45]. Genes are chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3 hydroxylase (F3H), flavonoid 3 hydroxylase (F3′H), flavonol synthase (FLS1), anthocyanidin synthase (ANS), and anthocyanidin reductase (ANR).

https://static-content.springer.com/image/art%3A10.1186%2F1756-0500-5-485/MediaObjects/13104_2012_Article_1865_Fig3_HTML.jpg
Figure 3

PCR confirmation of homozygous insertion lines for described tt alleles. T-DNA insertions were confirmed using T-DNA and gene-specific primers, while intact genes were confirmed using two gene-specific primers spanning the mapped T-DNA insertion site. Homozygous lines are indicated by the presence of a T-DNA insertion but not an intact gene.

End product and pigmentation analyses of tt alleles

Hydrolyzed flavonol extracts were analyzed by Ultra Performance Liquid Chromatography (UPLC) to provide phenotypic evidence of the gene disruptions identified by PCR. Five of the lines, tt4-13, tt5-2, tt5-3, tt6-3 and fls1-3, had no detectable levels of kaempferol or quercetin, the two major flavonol aglycones found in Arabidopsis (Figure 4). All five alleles affect enzymes upstream of flavonol production in the flavonoid biosynthetic pathway. As in previous analyses of the tt7-1 allele in the Landsberg (Ler) background, which lacks the F3H enzyme, tt7-5 in Col-0 also accumulated high levels of kaempferol but no detectable quercetin [46]. This is consistent with the catalytic role of F3H in converting dihydrokaempferol to dihydroquercetin. The tt11-11 and ban-4 mutants contain insertions in the ANS and ANR genes, respectively. Both lines accumulated flavonols at levels comparable to wild type but displayed other phenotypes characteristic of defects in the respective genes. The tt11-11 seeds exhibited an intermediate tt phenotype (Figure 1), but adult plants were devoid of red pigmentation, consistent with an absence of anthocyanins, while ban-4 exhibited a red seed coat in immature seeds and a darker black seed coat in fully desiccated seeds, as described previously for ban-1[41].
https://static-content.springer.com/image/art%3A10.1186%2F1756-0500-5-485/MediaObjects/13104_2012_Article_1865_Fig4_HTML.jpg
Figure 4

UPLC analysis of flavonol aglycone profiles in T-DNA insertion lines. A) UPLC traces of hydrolyzed extracts prepared from 5-day-old seedlings, with arrows indicating the retention times of the flavonols, quercetin (Q) and kaempferol (K). B) Comparison of kaempferol and quercetin levels determined from integrated peak areas.

Conclusions

The flavonoid mutants described in this report represent a useful toolset for the study of many aspects of plant metabolism, cell biology, and physiology. The flavonoid pathway provides a unique model system for studying metabolic pathways as it has been well-characterized in a variety of model organisms and is essential for a wide range of cellular and physiological processes. Mutations for genes encoding many of the enzymes now exist in a uniform genetic background. While this communication focuses on flavonoid biosynthetic enzymes, mutant alleles exist for genes involved in mediating other aspects of flavonoid metabolism, including transcriptional regulation of gene expression and modification and cellular transport of pathway end products [47, 48].

The flavonoid enzymes disrupted by T-DNA insertions have been hypothesized to participate in metabolic channeling via protein-protein interactions [7, 49]. These mutations, all within the same genetic background, could greatly enhance our understanding of the regulation and dynamics of this channeling, which has broad reaching implications across metabolic research areas. The CHS mutant allele, tt4-13, has already been used by our group and others to further probe the involvement of this pathway in modulating the distribution of auxin and ethylene within Arabidopsis seedling roots [7, 29, 36, 50], to characterize the distribution of flux among branch pathways of flavonoid metabolism [45], and to identify molecules that promote pollen fertilization in Arabidopsis[51]. The CHI allele, tt5-3, has been used in a metabolic profiling analysis of the response to UV light [52], whereas tt5-2 was used to demonstrate a requirement for this CHI gene, among flavonoid genes, for flavonol synthesis in pollen [30]. The flavanone 3-hydroxylase mutant, tt6-3, has been used to characterize the biochemical activities of Arabidopsis F3H and Sorghum FNS [33, 53], while the flavonoid 3-hydroxylase line, tt7-5, was used by our group in the auxin-ethylene study [36], and tt11-11, was already used several years ago to show that TDS4 is allelic to tt18 (now renamed tt11 per the findings of [38]) and encodes LDOX/ANS. The F3H and LDOX lines, tt6-3 and tt11-11, have been used to demonstrate the utility of a novel metabolic profiling method for intact seed [54].

The collection of tt mutants presented here represent a means to several ends. As our understanding of the roles flavonoid compounds play in human health evolve, so too may our need to develop new crop lines to deliver increased amounts of these compounds in our diet. In addition, the flavonoid pigmentation compounds are of great horticultural importance. For these two reasons alone a thorough understanding of the dynamic metabolic processes involved in flavonoid production is important, but there are broader benefits to many areas of cellular and plant biology.

Methods

Analysis of flavonol profiles

Arabidopsis (Columbia ecotype) wild-type and transgenic seeds were surface-sterilized as described previously [25]. Approximately 5 mg of seeds were dispersed on agar plates containing Murashige and Skoog salts with 1% sucrose and incubated 2 d in the dark at 4°C. The seeds were then grown on the surface of the agar medium under continuous white light (100 μE m-2 s-1) at 21°C as previously described [55]. Flavonols were extracted from frozen tissue by grinding 20 seedlings in 200 μl 1% acetic acid in 80% methanol and incubating overnight at 4°C. The samples were clarified by centrifugation twice at 13,000 rpm, 4°C for 15 min each time. The samples were hydrolyzed as described in Burbulis et al. [21], followed by the addition of an equal volume of 100% methanol and centrifugation as before.

Flavonols in wild-type and transgenic seedlings were profiled using a Waters Acquity UPLC system with a UPLC phenyl C18 column (2.1 mm x 100 mm, Waters) and a linear elution gradient from 100% solvent A (0.1% formic acid in water) to 40% solvent B (0.1% formic acid in acetonitrile) over 13 min at 4°C, modified from Yonekura-Sakakibara [56]. Chromatograms were collected at 320 nm and 365 nm.

Confirmation of knockouts by T-DNA insertion

Lines for each tt allele in Col-0 were ordered from the Arabidopsis Biological Resource Center (ABRC; The Ohio State University) and bred to homozygosity from a segregating population. The mapped locations of each T-DNA insertion were created using the T-DNA flanking sequence identified via the ABRC sequence viewer (Figure 2). To confirm that each line was homozygous, genomic DNA was extracted from one large leaf from each plant according to Edwards et al. [57] with slight modifications. Genomic DNA from Col-0 wild-type plants of approximately the same age was also extracted in the same manner to serve as a control template. Extracted genomic DNA was resuspended overnight in 100 μl ddH2O. PCR was performed using 1 to 2 μl of each sample with the primers listed in Table 2 in a total volume of 10–20 μl. PCR products were analyzed by agarose gel electrophoresis. Seeds for the tt5-3, tt7-5, and tt11-11 homozygous lines have been deposited with the ABRC; homozygous lines are available at the ABRC for the other four lines through the SALK Confirmed T-DNA Project.
Table 2

Primers used for confirmation of homozygous lines

Allele

Primer sequence (5'-3)

 

CHS: tt4-13

Intact Gene

GATCACTCATGTCGTCTTCTG

(SALK_020583)

 

AGGGCCAGGCGGTGAAG

 

T-DNA insertion

GATCACTCATGTCGTCTTCTG

  

TTAGAGAGGAACGCTGTGC

CHI: tt5-2

Intact Gene

ATGTCTTCATCCAACGCCTG

(CS300857)

 

GTTCTCTTTGGCTAGTTTTTC

 

T-DNA insertion

ATGTCTTCATCCAACGCCTG

CHI: tt5-3

Intact Gene

CGAAAGTAAGAATTAGAGAATAC

(SALK_034145)

 

AGGGCCAGGCGGTGAAG

 

T-DNA insertion

CGAAAGTAAGAATTAGAGAATAC TGATAAACTTCTCAAACGCAC

F3H: tt6-3

Intact Gene

TGGTAGGTAGCTAGCGAC

(SALK_113904)

 

AACACACCGCGCCTAGC

 

T-DNA insertion

TGGTAGGTAGCTAGCGAC

  

AGGGCCAGGCGGTGAAG

F3H: tt7-5

Intact Gene

CAGCGGATTGGAATTTGAAC

(SALK_053394)

 

CAGCTGTGAACATGTTCTG

 

T-DNA insertion

GGACCGCTTGCTGCAACT

  

CAGCTGTGAACATGTTCTG

ANS: tt11-11

Intact Gene

AGAGTTGAGAGTCTAGC

(SALK_073183)

 

GCAAAAGTCCGTGGAG

 

T-DNA insertion

AGAGTTGAGAGTCTAGC

  

TGGTTCACGTAGTGGGCCATCG

ANR: ban-4

Intact Gene

TGGACCAGACTCTTAC

(SALK_040250)

 

AGACCGGTCACATGC

 

T-DNA insertion

AGACCGGTCACATGC

  

TGGTTCACGTAGTGGGCCATCG

Abbreviations

ANR: 

anthocyanidin reductase

ANS: 

anthocyanidin synthase

BAN: 

Banyuls

CHI: 

chalcone isomerase

CHS: 

chalcone synthase

F3H: 

flavonoid 3-hydroxylase

FLS: 

flavonol synthase

F3H: 

flavanone 3-hydroxylase

tt

transparent testa

UPLC: 

Ultra performance liquid chromatography.

Declarations

Acknowledgments

The authors thank the Arabidopsis Biological Resource Center for providing seeds for T-DNA lines characterized in this report. We also acknowledge Brad Howard’s contribution to the analysis of the tt6-3 line. The work was supported by grants from the NSF Molecular Biochemistry (MCB-0445878) and IGERT (DGE-0523658) programs. Additional support for PB and MM was provided by the Molecular Plant Sciences Graduate Program at Virginia Tech.

Authors’ Affiliations

(1)
Department of Biological Sciences
(2)
Department of Biochemistry, Virginia Tech
(3)
Department of Biology, Colorado State University
(4)
Department of Microbiology, Immunology & Pathology, Colorado State University
(5)
Department of Plant Pathology, Physiology, and Weed Science, Virginia Tech

References

  1. Buer CS, Imin N, Djordjevic MA: Flavonoids: New roles for old molecules. J Integr Plant Biol. 2010, 52 (1): 98-111. 10.1111/j.1744-7909.2010.00905.x.PubMedView ArticleGoogle Scholar
  2. Lepiniec L, Debeaujon I, Routaboul JM, Baudry A, Pourcel L, Nesi N, Caboche M: Genetics and biochemistry of seed flavonoids. Annu Rev Plant Biol. 2006, 57: 405-430. 10.1146/annurev.arplant.57.032905.105252.PubMedView ArticleGoogle Scholar
  3. Prochazkova D, Bousova I, Wilhelmova N: Antioxidant and prooxidant properties of flavonoids. Fitoterapia. 2011, 82 (4): 513-523. 10.1016/j.fitote.2011.01.018.PubMedView ArticleGoogle Scholar
  4. Koes R, Verweij W, Quattrocchio F: Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 2005, 10 (5): 236-242. 10.1016/j.tplants.2005.03.002.PubMedView ArticleGoogle Scholar
  5. Winkel BSJ: The biosynthesis of flavonoids. The Science of Flavonoids. Edited by: Grotewold E. 2006, New York: Springer Science & Business Media, 71-95.View ArticleGoogle Scholar
  6. Austin MB, O’Maille PE, Noel JP: Evolving biosynthetic tangos negotiate mechanistic landscapes. Nat Chem Biol. 2008, 4 (4): 217-222. 10.1038/nchembio0408-217.PubMedPubMed CentralView ArticleGoogle Scholar
  7. Crosby KC, Pietraszewska-Bogiel A, Gadella TWJ, Winkel BSJ: Forster resonance energy transfer demonstrates a flavonoid metabolon in living plant cells that displays competitive interactions between enzymes. FEBS Lett. 2011, 585 (14): 2193-2198. 10.1016/j.febslet.2011.05.066.PubMedView ArticleGoogle Scholar
  8. Feller A, Machemer K, Braun EL, Grotewold E: Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. Plant J. 2011, 66 (1): 94-116. 10.1111/j.1365-313X.2010.04459.x.PubMedView ArticleGoogle Scholar
  9. Zhao J, Dixon RA: The ‘ins’ and ‘outs’ of flavonoid transport. Trends Plant Sci. 2010, 15 (2): 72-80. 10.1016/j.tplants.2009.11.006.PubMedView ArticleGoogle Scholar
  10. Hernandez I, Alegre L, Van Breusegem F, Munne-Bosch S: How relevant are flavonoids as antioxidants in plants?. Trends Plant Sci. 2009, 14 (3): 125-132. 10.1016/j.tplants.2008.12.003.PubMedView ArticleGoogle Scholar
  11. Santos CNS, Koffas M, Stephanopoulos G: Optimization of a heterologous pathway for the production of flavonoids from glucose. Metab Eng. 2011, 13 (4): 392-400. 10.1016/j.ymben.2011.02.002.PubMedView ArticleGoogle Scholar
  12. Tanaka Y, Brugliera F, Kalc G, Senior M, Dyson B, Nakamura N, Katsumoto Y, Chandler S: Flower color modification by engineering of the flavonoid biosynthetic pathway: Practical perspectives. Biosci Biotechnol Biochem. 2010, 74 (9): 1760-1769. 10.1271/bbb.100358.PubMedView ArticleGoogle Scholar
  13. Bürger D: Die morphologischen Mutanten des Göttinger Arabidopsis-Sortiment, einschliesslich der Mutanten mit abweichender Samenfarbe. Arabid Inf Serv. 1971, 8: 36-42.Google Scholar
  14. Koornneef M: Mutations affecting the testa color in Arabidopsis. Arabid Inf Serv. 1990, 28: 1-4.Google Scholar
  15. Koornneef M, Dellaert LW, van der Veen JH: EMS- and radiation-induced mutation frequencies at individual loci in Arabidopsis thaliana (L.) Heynh. Mutat Res. 1982, 93 (1): 109-123. 10.1016/0027-5107(82)90129-4.PubMedView ArticleGoogle Scholar
  16. Beemster GTS, De Vusser K, De Tavernier E, De Bock K, Inze D: Variation in growth rate between Arabidopsis ecotypes is correlated with cell division and A-type cyclin-dependent kinase activity. Plant Physiol. 2002, 129 (2): 854-864. 10.1104/pp.002923.PubMedPubMed CentralView ArticleGoogle Scholar
  17. Chevalier F, Martin O, Rofidal V, Devauchelle AD, Barteau S, Sommerer N, Rossignol M: Proteomic investigation of natural variation between Arabidopsis ecotypes. Proteomics. 2004, 4 (5): 1372-1381. 10.1002/pmic.200300750.PubMedView ArticleGoogle Scholar
  18. Maloof JN, Borevitz JO, Dabi T, Lutes J, Nehring RB, Redfern JL, Trainer GT, Wilson JM, Asami T, Berry CC, et al: Natural variation in light sensitivity of Arabidopsis. Nat Genet. 2001, 29 (4): 441-446. 10.1038/ng777.PubMedView ArticleGoogle Scholar
  19. Alonso J, Stepanova A, Leisse T, Kim C, Chen H, Shinn P, Stevenson D, Zimmerman J, Barajas P, Cheuk R, et al: Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 2003, 301: 653-657. 10.1126/science.1086391.PubMedView ArticleGoogle Scholar
  20. Feinbaum RL, Ausubel FM: Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene. Mol Cell Biol. 1988, 8 (5): 1985-1992.PubMedPubMed CentralView ArticleGoogle Scholar
  21. Burbulis IE, Iacobucci M, Shirley BW: A null mutation in the first enzyme of flavonoid biosynthesis does not affect male fertility in Arabidopsis. Plant Cell. 1996, 8 (6): 1013-1025.PubMedPubMed CentralView ArticleGoogle Scholar
  22. Brown DE, Rashotte AM, Murphy AS, Normanly J, Tague BW, Peer WA, Taiz L, Muday GK: Flavonoids act as negative regulators of auxin transport in vivo in Arabidopsis thaliana. Plant Physiol. 2001, 126: 524-535. 10.1104/pp.126.2.524.PubMedPubMed CentralView ArticleGoogle Scholar
  23. Bennett T, Sieberer T, Willett B, Booker J, Luschnig C, Leyser O: The Arabidopsis MAX pathway controls shoot branching by regulating auxin transport. Current Biology. 2006, 16 (6): 553-563. 10.1016/j.cub.2006.01.058.PubMedView ArticleGoogle Scholar
  24. Shikazono N, Yokota Y, Tanaka A, Watanabe H, Tano S: Molecular analysis of carbon ion-induced mutations in Arabidopsis thaliana. Genes Genet Syst. 1998, 73 (3): 173-179. 10.1266/ggs.73.173.PubMedView ArticleGoogle Scholar
  25. Saslowsky DE, Dana CD, Winkel-Shirley B: An allelic series for the chalcone synthase locus in Arabidopsis. Gene. 2000, 255 (2): 127-138. 10.1016/S0378-1119(00)00304-8.PubMedView ArticleGoogle Scholar
  26. Bharti AK, Khurana JP: Molecular characterization of transparent testa (tt) mutants of Arabidopsis thaliana (ecotype Estland) impaired in flavonoid biosynthetic pathway. Plant Sci. 2003, 165 (6): 1321-1332. 10.1016/S0168-9452(03)00344-3.View ArticleGoogle Scholar
  27. Routaboul JM, Kerhoas L, Debeaujon I, Pourcel L, Caboche M, Einhorn J, Lepiniec L: Flavonoid diversity and biosynthesis in seed of Arabidopsis thaliana. Planta. 2006, 224: 96-107. 10.1007/s00425-005-0197-5.PubMedView ArticleGoogle Scholar
  28. Rosso MG, Li Y, Strizhov N, Reiss B, Dekker K, Weisshaar B: An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol. 2003, 53 (1–2): 247-259.PubMedView ArticleGoogle Scholar
  29. Buer CS, Sukumar P, Muday GK: Ethylene modulates flavonoid accumulation and gravitropic responses in roots of Arabidopsis. Plant Physiology. 2006, 140 (4): 1384-1396. 10.1104/pp.105.075671.PubMedPubMed CentralView ArticleGoogle Scholar
  30. Stracke R, Jahns O, Keck M, Tohge T, Niehaus K, Fernie AR, Weisshaar B: Analysis of PRODUCTION OF FLAVONOL GLYCOSIDES-dependent flavonol glycoside accumulation in Arabidopsis thaliana plants reveals MYB11-, MYB12-and MYB111-independent flavonol glycoside accumulation. New Phytol. 2010, 188 (4): 985-1000. 10.1111/j.1469-8137.2010.03421.x.PubMedView ArticleGoogle Scholar
  31. Zhang F, Maeder ML, Unger-Wallace E, Hoshaw JP, Reyon D, Christian M, Li XH, Pierick CJ, Dobbs D, Peterson T, et al: High frequency targeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases. P Natl Acad Sci USA. 2010, 107 (26): 12028-12033. 10.1073/pnas.0914991107.View ArticleGoogle Scholar
  32. Wisman E, Hartmann U, Sagasser M, Baumann E, Palme K, Hahlbrock K, Saedler H, Weisshaar B: Knock-out mutants from an En-1 mutagenized Arabidopsis thaliana population generate phenylpropanoid biosynthesis phenotypes. Proc Natl Acad Sci USA. 1998, 95: 12432-12437. 10.1073/pnas.95.21.12432.PubMedPubMed CentralView ArticleGoogle Scholar
  33. Owens DK, Crosby KC, Runac J, Howard BA, Winkel BSJ: Biochemical and genetic characterization of Arabidopsis flavanone 3 beta-hydroxylase. Plant Physiology and Biochemistry. 2008, 46 (10): 833-843. 10.1016/j.plaphy.2008.06.004.PubMedView ArticleGoogle Scholar
  34. Schoenbohm C, Martens S, Eder C, Forkmann G, Weisshaar B: Identification of the Arabidopsis thaliana flavonoid 3'-hydroxylase gene and functional expression of the encoded P450 enzyme. Biol Chem. 2000, 381 (8): 749-753.PubMedView ArticleGoogle Scholar
  35. Abrahams S, Tanner GJ, Larkin PJ, Ashton AR: Identification and biochemical characterization of mutants in the proanthocyanidin pathway in Arabidopsis. Plant Physiol. 2002, 130 (2): 561-576. 10.1104/pp.006189.PubMedPubMed CentralView ArticleGoogle Scholar
  36. Lewis DR, Ramirez MV, Miller ND, Vallabhaneni P, Ray WK, Helm RF, Winkel BSJ, Muday GK: Auxin and ethylene induce flavonol accumulation through distinct transcriptional networks. Plant Physiology. 2011, 156 (1): 144-164. 10.1104/pp.111.172502.PubMedPubMed CentralView ArticleGoogle Scholar
  37. Shirley B, Hanley S, Goodman H: Effects of ionizing radiation on a plant genome: analysis of two Arabidopsis transparent testa mutations. Plant Cell. 1992, 4 (3): 333-PubMedPubMed CentralView ArticleGoogle Scholar
  38. Appelhagen I, Jahns O, Bartelniewoehner L, Sagasser M, Weisshaar B, Stracke R: Leucoanthocyanidin dioxygenase in Arabidopsis thaliana: characterization of mutant alleles and regulation by MYB-BHLH-TTG1 transcription factor complexes. Gene. 2011, 484 (1–2): 62-69.Google Scholar
  39. Abrahams S, Lee E, Walker AR, Tanner GJ, Larkin PJ, Ashton AR: The Arabidopsis TDS4 gene encodes leucoanthocyanidin dioxygenase (LDOX) and is essential for proanthocyanidin synthesis and vacuole development. Plant J. 2003, 35 (5): 624-636. 10.1046/j.1365-313X.2003.01834.x.PubMedView ArticleGoogle Scholar
  40. Shikazono N, Yokota Y, Kitamura S, Suzuki C, Watanabe H, Tano S, Tanaka A: Mutation rate and novel tt mutants of Arabidopsis thaliana induced by carbon. Genetics. 2003, 163 (4): 1449-1455.PubMedPubMed CentralGoogle Scholar
  41. Albert S, Delseny M, Devic M: BANYULS, a novel negative regulator of flavonoid biosynthesis in the Arabidopsis seed coat. Plant J. 1997, 11 (2): 289-299. 10.1046/j.1365-313X.1997.11020289.x.PubMedView ArticleGoogle Scholar
  42. Devic M, Guilleminot J, Debeaujon I, Bechtold N, Bensaude E, Koornneef M, Pelletier G, Delseny M: The BANYULS gene encodes a DFR-like protein and is a marker of early seed coat development. Plant J. 1999, 19 (4): 387-398. 10.1046/j.1365-313X.1999.00529.x.PubMedView ArticleGoogle Scholar
  43. Preuss A, Stracke R, Weisshaar B, Hillebrecht A, Matern U, Martens S: Arabidopsis thaliana expresses a second functional flavonol synthase. FEBS Lett. 2009, 583 (12): 1981-1986. 10.1016/j.febslet.2009.05.006.PubMedView ArticleGoogle Scholar
  44. Stracke R, De Vos RCH, Bartelniewoehner L, Ishihara H, Sagasser M, Martens S, Weisshaar B: Metabolomic and genetic analyses of flavonol synthesis in Arabidopsis thaliana support the in vivo involvement of leucoanthocyanidin dioxygenase. Planta. 2009, 229: 427-445. 10.1007/s00425-008-0841-y.PubMedView ArticleGoogle Scholar
  45. Owens DK, Alerding AB, Crosby KC, Bandara AB, Westwood JH, Winkel BSJ: Functional analysis of a predicted flavonol synthase gene family in Arabidopsis. Plant Physiol. 2008, 147 (3): 1046-1061. 10.1104/pp.108.117457.PubMedPubMed CentralView ArticleGoogle Scholar
  46. Pelletier M, Burbulis I, Winkel-Shirley B: Disruption of specific flavonoid genes enhances the accumulation of flavonoid enzymes and end-products in Arabidopsis seedlings. Plant Mol Biol. 1999, 40 (1): 45-54. 10.1023/A:1026414301100.PubMedView ArticleGoogle Scholar
  47. Debeaujon I, Peeters AJ, Leon-Kloosterziel KM, Koornneef M: The transparent testa12 gene of Arabidopsis encodes a multidrug secondary transporter-like protein required for flavonoid sequestration in vacuoles of the seed coat endothelium. Plant Cell. 2001, 13 (4): 853-871.PubMedPubMed CentralView ArticleGoogle Scholar
  48. Nesi N, Debeaujon I, Jond C, Pelletier G, Caboche M, Lepiniec L: The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell. 2000, 12 (10): 1863-1878.PubMedPubMed CentralView ArticleGoogle Scholar
  49. Burbulis I, Winkel-Shirley B: Interactions among enzymes of the Arabidopsis flavonoid biosynthetic pathway. Proc Natl Acad Sci U S A. 1999, 96 (22): 12929-10.1073/pnas.96.22.12929.PubMedPubMed CentralView ArticleGoogle Scholar
  50. Vanholme R, Ralph J, Akiyama T, Lu F, Pazo JR, Kim H, Christensen JH, Van Reusel B, Storme V, De Rycke R, et al: Engineering traditional monolignols out of lignin by concomitant up-regulation of F5H1 and down-regulation of COMT in Arabidopsis. Plant J. 2010, 64 (6): 885-897. 10.1111/j.1365-313X.2010.04353.x.PubMedView ArticleGoogle Scholar
  51. Qin Y, Wysocki RJ, Somogyi A, Feinstein Y, Franco J, Tsukamoto T, Dunatunga D, Clara L, Smith D, Simpson R, et al: Sulfinylated azadecalins act as functional mimics of a pollen germination stimulant in Arabidopsis pistils. Plant J. 2011, 68 (5): 800-815. 10.1111/j.1365-313X.2011.04729.x.PubMedPubMed CentralView ArticleGoogle Scholar
  52. Kusano M, Tohge T, Fukushima A, Kobayashi M, Hayashi N, Otsuki H, Kondou Y, Goto H, Kawashima M, Matsuda F, et al: Metabolomics reveals comprehensive reprogramming involving two independent metabolic responses of Arabidopsis to UV-B light. Plant J. 2011, 67 (2): 354-369. 10.1111/j.1365-313X.2011.04599.x.PubMedView ArticleGoogle Scholar
  53. Du YG, Chu H, Wang MF, Chu IK, Lo C: Identification of flavone phytoalexins and a pathogen-inducible flavone synthase II gene (SbFNSII) in sorghum. Journal of Experimental Botany. 2010, 61 (4): 983-994. 10.1093/jxb/erp364.PubMedPubMed CentralView ArticleGoogle Scholar
  54. Kim SW, Kim HJ, Kim JH, Kwon YK, Ahn MS, Jang YP, Liu JR: A rapid, simple method for the genetic discrimination of intact Arabidopsis thaliana mutant seeds using metabolic profiling by direct analysis in real-time mass spectrometry. Plant Methods. 2011, 7: 14-10.1186/1746-4811-7-14.PubMedPubMed CentralView ArticleGoogle Scholar
  55. Saslowsky D, Winkel-Shirley B: Localization of flavonoid enzymes in Arabidopsis roots. Plant J. 2001, 27: 37-48. 10.1046/j.1365-313x.2001.01073.x.PubMedView ArticleGoogle Scholar
  56. Yonekura-Sakakibara K, Tohge T, Matsuda F, Nakabayashi R, Takayama H, Niida R, Watanabe-Takahashi A, Inoue E, Saito K: Comprehensive flavonol profiling and transcriptome coexpression analysis leading to decoding gene-metabolite correlations in Arabidopsis. Plant Cell. 2008, 20 (8): 2160-2176. 10.1105/tpc.108.058040.PubMedPubMed CentralView ArticleGoogle Scholar
  57. Edwards K, Johnstone C, Thompson C: A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res. 1991, 19 (6): 1349-10.1093/nar/19.6.1349.PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

© Bowerman et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement