Skip to main content

Table 5 MicroRNAs predicted to target the 3'UTR of SYNJ1 at the location of SNP bSYNJ1_C3981T.

From: Single nucleotide polymorphisms concordant with the horned/polled trait in Holsteins

microRNA miRBase Accession Mature Sequence (5'-3') Reference
bta-let-7a MIMAT0003844 UGAGGUAGUAGGUUGUAUAGUU [29]
bta-let-7b MIMAT0004331 UGAGGUAGUAGGUUGUGUGGUU [29]
bta-let-7e MIMAT0004333 UGAGGUAGGAGGUUGUAUAGU [29]
bta-let-7f MIMAT0003519 UGAGGUAGUAGAUUGUAUAGUU [29]
bta-let-7g MIMAT0003838 UGAGGUAGUAGUUUGUACAGUU [29]
bta-let-7i MIMAT0003851 UGAGGUAGUAGUUUGUGCUGUU [29]
bta-miR-98 MIMAT0003809 UGAGGUAGUAAGUUGUAUUGUU [30]
bta-miR-145 MIMAT0003542 GUCCAGUUUUCCCAGGAAUCCCU [29]