Skip to main content

Table 1 Primer pairs used for real time quantitative RT-PCR

From: Synergistic effect of methyljasmonate and cyclodextrin on stilbene biosynthesis pathway gene expression and resveratrol production in Monastrell grapevine cell cultures

Gene abbreviation Gene definition GenBank accession Unigene ID Primer pair
(5'-forward-3'/5'-reverse-3')
Product size
(bp)
STS1 Stilbene synthase1 DQ366301 Vvi.8 CGAAGCAACTAGGCATGTGT/CTCCCCAATCCAATCCTTCA 134
STS2 Stilbene synthase2 DQ366302 Vvi.8 ACCAAAGTCCAAGATCACCCA/ACAACATCACCCTTCTAACCGAT 122
PAL1 Phenylalanine ammonia lyase EC987386 Vvi.1950 CCGAACCGAATCAAGGACTG/GTTCCAGCCACTGAGACAAT 183
C4H1 Cinnamate-4-hydroxylse EC995763 Vvi.6228 AAAGGGTGGGCAGTTCAGTT/GGGGGGTGAAAGGAAGATAT 109
4CL1 4-coumarate-CoA ligase EC947790 Vvi.1251 CTGATGCCGCTGTTGTTTCG/GCAGGATTTTACCCGATGGA 198
CHS1 Chalcone synthase1 EC996578 Vvi.117 GTCCCAGGGTTGATTTCCAA/TCTCTTCCTTCAGACCCAGTT 157
CHS2 Chalcone synthase2 EC996527 Vvi.1973 TTTGGGCATCAAGGACTGGA/CTCGGGCTTTAGGGCTAAT 100
CCR2 Cinnamoyl-CoA reductase CF517687 Vvi.15864 ACAGCATGACGACTCTCTTCG/AGTGACAAGGGGTGGATTGA 182