Skip to main content

Table 1 Primers and RT-PCR conditions

From: SR proteins and the nonsense-mediated decay mechanism are involved in human GLB1 gene alternative splicing

Primers employed in the RT-PCR RT-PCRs performed
Primer Sequence (5'->3') GLB1 Exona Transcript specificity Pairs of primers employed AT (°C)
C1F ACTGCAGAGCCGGGAGGCTGGT 1 EBP/β-Gal C1F/EBPR 58
C3R CCAAAGTGACCTTTCCATATG 11 EBP/β-Gal EBPF/C3R 56.5
EBPF GGCTGAACGCCATCCAGACATT 2–5 EBP T7/SP6 55
EBPR TGATGTTGCTGCCTGCACTG 7–5 EBP T7/EBPR 56.5
2_4F ACGCCATCCAGACGGAGGAT 2–4 NN EBPF/SP6 58
4_6F TCCTCCGACCCAGGTTGAA 4–6 NN 2_4F/C3R 59
T7 TAATACGACTCACTATAGGG -- pcDNA3 2_4F/SP6 58.3
SP6 GATTTAGGTGACACTATAG -- pcDNA3 4_6F/C3R 59
C1Fm GAGACCCCATCGTGGCGCGA 1 m EBP/β-Gal C1Fm/C1Rm 59
C1Rm CTCTAGTAGCCAAGCAGGTAAGC 4 m β-Gal EBPFm/EBPRm 58
EBPFm GGGCTGAATGCTATCCAGATAC 2–5 m EBP   
EBPRm TGTGATATTGTTGCCTGCACGGT 7–5 m EBP   
  1. AT: annealing temperature; NN: not naturally ocurring; m:mouse.
  2. aGLB1 exon or exons that are complementary to the indicated primers