Skip to main content

Table 1 Details on exon-spanning primers used for splice variant detection.

From: Two new splice variants in porcine PPARGC1A

Primer name Primer sequence (5'→3') Location Amplicon length
PGC1A+Ex1,3 CATGTGCAACCAGGACTCTGT Exon 1 294 bp
PGC1A-Ex1,3 TCTTCATCCACAGGGAGACTG Exon 3  
PGC1A+Ex2,4 TTCTGGGTGGACTCAAGTGG Exon 2 367 bp
PGC1A-Ex2,4 TTGTGGTTTGCATGGTTCTG Exon 4  
PGC1A+Ex3,5 CCCTGTGGATGAAGACGGATT Exon 3 367 bp
PGC1A-Ex3,5 AGGAGGGTCATCATTTGTGGT Exon 5  
PGC1A+E4,6 CAGAACCATGCAAACCACAA Exon 4 296 bp
PGC1A-Ex4,6 TCTGGGGTCAGAGGAAGAGAT Exon 6  
PGC1A+Ex5,7 CAACAGCAAAAGCCACAAAGA Exon 5 284 bp
PGC1A-Ex5,7 CAGTTCCAGAGAGTTCC Exon 7  
PGC1A+Ex6,8 ATCTCTTCCTCTGACCCCAGA Exon 6 266 bp
PGC1A-Ex6,8 TCTTGGTGGAGTTGTTGCC Exon 8  
PGC1A+E7,9 TGTGGAACTCTCTGGAACTGC Exon 7 1017 bp
PGC1A-Ex7,9 GAACGTGATCTGGCGCAC Exon 9  
PGC1A+E8,10 TTCCGTATCACCACCCAAA Exon 8 298 bp
PGC1A-Ex8,10 TTCCCTCTTCAGCCTCTCG Exon 10  
PGC1A+Ex9,11 TACTCTGAGTCAGGCCACTGC Exon 9 302 bp
PGC1A-Ex9,11 TCACCAAAAACTTCAAAACGG Exon 11  
PGC1A+Ex10,12 CGAGAGGCTGAAGAGGGAA Exon 10 267 bp
PGC1A-Ex10,12 GCAGCAAAAGCATCACAGG Exon 12  
PGC1A+Ex11,13 AGGGACCGTTTTGAAGTTTTT Exon 11 255 bp
PGC1A-Ex11,13 GCTCTTGGTGGAAGCAGGA Exon 13