Skip to main content

Table 4 SP values of experimentally-determined exonic splicing silencers.

From: Calculation of Splicing Potential from the Alternative Splicing Mutation Database

No Name ESS Cum SP value SP per triplet Core Cum SP value
1 R0624 agatcctagactagagcct -0.12 -0.01 -1.31
2 R0628 ccaagtcaaaatttac -1.09 -0.08 -1.12
3 R0629 tgtggg -0.86 -0.22 -0.86
4 R0632 agatccattcgattagtgaa 1.18 0.06 -1.23
5 R0634 taagtgttctgagct 0.34 0.03 -0.82