Table 4 SP values of experimentally-determined exonic splicing silencers.
From: Calculation of Splicing Potential from the Alternative Splicing Mutation Database
No | Name | ESS | Cum SP value | SP per triplet | Core Cum SP value |
|---|---|---|---|---|---|
1 | R0624 | agatcctagactagagcct | -0.12 | -0.01 | -1.31 |
2 | R0628 | ccaagtcaaaatttac | -1.09 | -0.08 | -1.12 |
3 | R0629 | tgtggg | -0.86 | -0.22 | -0.86 |
4 | R0632 | agatccattcgattagtgaa | 1.18 | 0.06 | -1.23 |
5 | R0634 | taagtgttctgagct | 0.34 | 0.03 | -0.82 |