Skip to main content

Advertisement

Table 1 Oligonucleotide primers used for qRT-PCR analysis

From: Streptococcus pneumoniaeearly response genes to human lung epithelial cells

Gene name TIGR4 genome acc. No. Oligonucleotide primers 5' to 3' Amplified product (bp)
purH SP0050 Sense: TCAAGCAACCAATGCGTTACGGTGAG 110
   Anti-sense: TTTCCCGTTGAGCTGTTTGGCTGAAG  
strH SP0057 Sense: GTGTCAGCCCAAGCAGCTACCATACCAC 128
   Anti-sense: GGCCAAGGCTGGTACAATCTCGATCAGG  
cbpI SP0069 Sense: GCTATGAAGACAGGCTGGTACAAG 133
   Anti-sense: TCACAGCCAAAGCTCCTGAAC  
nrdD SP0202 Sense: TGCAACCAAGCGGATGTATCCAGACG 99
   Anti-sense: TGAAGGAAAGAACGGCAGCCCATAGG  
  SP0287 Sense: CAGTCGGTGCCATTGCAGGTACTTCAAAC 103
   Anti-sense: GCTACAACCAAGGCTGTCAAACCAGTACG  
caps4A SP0346 Sense: GTCAGAGTATCCAGACTACGCATCGAAG 159
   Anti-sense: TCTGATCGCGACACCGAACTAATAGG  
bgaA SP0648a Sense: CAAGCCAGCCGTGAACGCTATAAGG 128
   Anti-sense: GAGTGGGCAGTCAGGGTGAATTTCC  
gyrA SP1219a Sense: GTGCTGCCGCTCAACGTTATACCGAGG 142
   Anti-sense: AAACGCGCTGGCAAGACCAAGGGTTCC  
pyrR SP1278 Sense: GACAGACCGCGAAGTTATCTTGGTGG 115
   Anti-sense: AACTGCTAAACTCACACGCGCAGGAC  
  SP1679 Sense: GGACAGGGGATTACAGTTGATGAGATGG 149
   Anti-sense: GCAGTTGCAGCTACCCTACTTAAGATCG  
  SP1680 Sense: GCCTGCATAACCATTTGGCTGATGTG 127
   Anti-sense: AGCATTCGACGAAGCGAGTGACATTG  
  SP1688 Sense: AAGTGAACGAAGGGCTACTGCTACTGTC 136
   Anti-sense: GCTACCGATTGTAGCACCAGGTATTG  
nanA SP1693 Sense: GACATATTCGAAAGCGGGCGTAACGG 117
   Anti-sense: GCGTTCATCTGCACCTGCGATCAAAG  
purR SP1979a Sense: AGGCAGCCGTGTCTTGATTGTGG 120
   Anti-sense: TTGTCCGCAAAGACCGCTACACC  
  1. a. Obtained from [7].