Skip to main content

Advertisement

Table 1 Primer and probe sequences

From: Differential susceptibility of PCR reactions to inhibitors: an important and unrecognised phenomenon

Reaction Oligoδ Sequence
Pj HSP70a F CGTCTTGTAAACCACTTCATTGC
  R AGTCCGTTTAGCACGCTCAC
  P HEX 5' AAGA AA GA TCTT TCAG GG 3' BHQ1*
mtLSU133 F GCACTGAATATCTCGAGGGA
  R ACTGTTCTGGGCTGTTTCC
  P HEX 5' CTT ATC GCA CAT AGT CTG ATT 3'BHQ1*
CFP32 F AGAAGCGAATACAGGCAAGG
  R CGGACTGATCGGTGGTCT
  P HEX 5' CGCCGAACTGGGTCGACCTTC 3' BHQ1
IS1081 F CTGCTCTCGACGTTCATCGCCG
  R GGCACGGGTGTCGAAATCACG
  P HEX 5' ATTGGACCGCTCATCGCTGCGTTCGC 3' BHQ1
16S MTb F CAAGTCGAACGGAAAGGTCT
  R GCAGATCACCCACGTGTTAC
  P HEX 5' CCCGTTCGCCACTCGAGTATCTC 3' BHQ1
SPUD F AACTTGGCTTTAATGGACCTCCA
  R ACATTCATCCTTACATGGCACCA
  P FAM 5'TGCACAAGCTATGGAACACCACGT 3' BHQ1
  1. n.b. δ Oligos; F: forward primer, R: reverse primer, P: hydrolysis probe.
  2. * underline denotes locked nucleic acid (LNA) moieties