Skip to main content

Advertisement

Table 1 Confirmation primers designed and directly re-amplified from HLB-infected samples.

From: Comparative phylogenomics and multi-gene cluster analyses of the Citrus Huanglongbing (HLB)-associated bacterium Candidatus Liberibacter

Target region Forward primers (5'-3') Reverse Primers (5'-3') Amplicon
size
(bp)
Region-1    
  Region-1-L-F GGTCAATTCAATGCGCTATAC Region-1-L-R CAGGAATCTGTCGAGCAATGG 3,308
  Region-1-R-F1 GGCATGTGTTGGTCTTGGAA Region-1-R-R1 TCGGTGATTCAATAATTTCC 3,019
  Region-1-R-F 2 CTCAATGGTGGCAGTTCGCTG Region-1-R-R2 TTCTTTCCCAAGACCAACACATGC 398
RpoB Las primer RpoB-las-F AATTTTTCTGTTCCTCGCAGC RpoB-las-R CAGCGAACTGCCACCATTGAG 1,530
RpoB Las & Laf common primer pair RpoB-las-laf-F TCAACTTGAAGAACATGTGAACTCTCTTTCGC RpoB-las-laf-R CAGCGAACTGCCACCATTGAG 1,508
Region-2    
  Region-2-L-F GCGGGCCTGTTGATAATCCTGC Region-2-L-R CACATAACCAAGTCAACCCA 1,931
  Region-2-R-F CAACAACCCTGACCTCCATC Region-2-R-R CACAGTTTCATAGCCTCCCA 1,041
Region-3    
  Region-3-L-F GCAGCTGGAAGGGGATTCAC Region-3-L-R GATAGCACCCTGATATTACACAA 4,150
  Region-3-R-F GAGGAACCGTTGAGTATGGC Region-3-R-R TTTCTACAGTCTACGATGCG 1,124
  1. Primers were designed based on the DNA sequences obtained by a genomic walking protocol. Amplification parameters are detailed in the Methods section.