Skip to main content

Table 1 Primers used for amplifying M. tuberculosis target DNA

From: PCR diagnostics of Mycobacterium tuberculosis in historic human long bone remains from 18th century burials in Kaiserebersdorf, Austria

Primer Length of product Sequence 5' – 3' Reference
IS1081_F2 135 bp CTGCTCTCGACGTTCATCGCCG Insertion sequence IS1081
IS1081_R2   GGCACGGGTGTCGAAATCACG [2]
IS1081_R3 113 bp TGGCGGTAGCCGTTGCGC  
OxyR_F3 110 bp CACTGCCTACGCGACCAGACG oxidative stress regulator OxyR pseudogene
OxyR _R1   TCTGCGGAATCAGTGTCACC [2]
OxyR _F4 94 bp AGACGCTCGATGCTGCCCAA  
pncA_F2 117 bp GGCGGACTACCATCACGTCG Pyrazinamidase gene
pncA _R2   GGAGTACCGCTGACGCAATGCGGT [2]
pncA _R3 96 bp GGCCACGACGAGGAATAGTC  
D1flanking_F 112 bp ATCGAAAGGCTAACGGGTGC flanking sections of TbD1 region
D1flanking _R2   CTGCTCGCCGAGTTGGTCGATA [2]
D1flanking _R3 96 bp TCGATACCGTCGATCGTGTCAAAG  
D1internal _F3 115 bp CGAGCTACGACGCTCGCTATTA TbD1 region
D1internal _R3   GCATATCGTGATCCGTCTCGAT [2]
D1internal _R4 105 bp CTCGATCATCAGTAGTTCGGGATTC  
TbA TbA/TbB: CTCGTCCAGCGCCGCTTCGG insertion sequence IS6110
TbB 120 bp CCTGCGAGCGTAGGCGTCGG [1]
TbC TbC/TbD: GCTTCGGACCACCAGCACCT  
TbD 95 bp GCGTCGGTGACAAAGGCCAC  
  1. For the primers of [2], F (forward) and R (reverse) denote orientation of the primer and for each gene amplification was performed with the first two primers followed by reamplification with the third primer in combination with one of the original primers.
  2. Target Sequences: IS108 = Insertion sequence IS1081; OxyR = oxidative stress regulator OxyR pseudogene; pncA = Pyrazinamidase gene; D1 = TbD1 region described in [25] that is deleted in modern strains of M. tuberculosis; TbA-TbD: insertion sequence IS6110.
\