Skip to main content

Table 1 List of pear EST-based SSR markers tested in apple.

From: Update on comparative genome mapping between Malus and Pyrus

SSR locus accession Location on pear
consensus map
Location on
apple
consensus map
Forward primer (5'-3') Reverse primer (5'-3')
TsuENH001 AB450689 LG2 LG2 AAAGACGGCATTGACTGGATAGA gtttcttGATGCAAAGACTTTCGCCTATCT
TsuENH004 AB450692 LG4, 12 LG4 CGCATTAAAGTCTGGCTTTCTTC gtttcttGAATTGGCAGAGAGATTGAGTGG
TsuENH008 AB450696 LG9 LG13 CTGAGGTCTCATTCGGTGATTCT gtttcttCCTTCTCTGCTTTCTTCTTCACG
TsuENH011 AB450698 LG6, 14 LG6 CGCTTATCCGTTAAACTTCA gtttcttCAACGACAGTTCGAATAGGA
TsuENH016 AB450701 LG15 LG15 TCATTTCATGGACTCTCAATCTCC gtttcttCGAGGAGTCTGTCTGCGTCT
TsuENH022 AB450705 LG16 LG16 CCAATTCATCGAAGTTTACATAGGG gtttcttGGCCAAAGTGCATGAGATGTAGT
TsuENH023 AB450706 LG3 LG3 TCTTCTTCACAGGTCACAACAGC gtttcttCTATGCGCTGCTTCTTGGTAGTC
TsuENH031 AB450711 LG14 LG14 CATTTCCTTAGCTCCCTCCAGTT gtttcttGAACCTTCCTCTTCCCATCACTT
TsuENH032 AB450712 LG14 LG14 AACTGGAGGGAGCTAAGGAAATG gtttcttCATCAAACAAAACTAGCCGAACC
TsuENH033 AB450713 LG17 LG17 CCTGAGGTTATTGACCCAAAAGA gtttcttGGTGGATACTCACTCAGTTGGAAA
TsuENH034 AB450714 LG8 LG8 GCCCCCAATATTTTCCCATTAT gtttcttGTTGGTGTTTGAGTCAACGTGAG
TsuENH042 AB450718 LG13, 16 LG16 AAAGCCGTACATTAGGCAAACC gtttcttAAAACTAGAACAGGCAGCCACAG
TsuENH043 AB450719 LG10 LG10 CATCTGCGTCCGGCAAAC gtttcttGCCCCCTGATATTCGTGGAT
TsuENH046 AB450722 LG6 LG6 GGTCATCACCCACTTAAAAACCA gtttcttGTGCCCTGAAGTAATTGAGATGG
TsuENH049 AB450724 LG1 LG1 CATCAGCCTACGAGCACATACAC gtttcttAGATTACGGCAACAGCAACAGAT
TsuENH052 AB450726   LG13, LG16 CCCAGCAGCCTCCTAATCAATA gtttcttTAGTTGTAGTCCTGCCCAAGTCC
TsuENH058 AB450730 LG14 LG14 AGAAGAAGGATAAGAAGAAGGATGG gtttcttGTAACGAAAAGGAAACAGGACTTG
TsuENH060 AB450732   LG10 ATCTCCACCCAAGAAACCTTACC gtttcttGGGGGTGAGGAATAGATGTAACC
TsuENH062 AB450733 LG2 LG2 ACTCAGATCGTACGCAGAACAAA gtttcttCGATAAAGATCGATAATCCTCATGC
TsuENH066 AB450736   LG13 GTGGTGGAGGTGCGTATTGAC gtttcttCGAGGAAAAGTGCGACTCGT
TsuENH068 AB450738   LG5 CCAATTTTCTCTTCCTCCCTGTT gtttcttTTACAGTTATTGCCGAAGCCAAG
TsuENH076 AB450743   LG10 CATTAATACGCTGCTGTTTCTGC gtttcttACTTGAATTGGGGTAGGGATTGT
TsuENH079 AB450745 LG16 LG13 GCGGCTTCTTGGGAGAAGGT gtttcttGCATGCTCCTTTTGACAGCCTAC
TsuENH081 AB450747   LG13 GCTCTCCTCTTCTTCTCCCACTC gtttcttCCACCCTCGTCAAAATCAGAGTA
TsuENH082 AB450748   LG11 CACCAGTACTCCTGGAGGGTTTC gtttcttGTGCTCCTGCAACATTTTCTCC
TsuENH083 AB450749 LG11 LG11 ACTCTCCGCAAAACAATGTCGTA gtttcttTGTGAGAGTTTGAGGAGGAGAGC
TsuENH086 AB450751 LG5 LG5 CTCTGTTCTGCTTCGATTCTGCT gtttcttGTCCACGTTCACCATTTTTCAGT
TsuENH093 AB450757 LG15 LG8, LG15 GTGGAGATTTTCCGAGTCAAATG gtttcttAATAAGACTGCTGAGGGAATCCA
TsuENH096 AB450759 LG15 LG8 AGTGAGAGAGAGAGGCCTTGGTT gtttcttGCTCTTGCTCTGTCTTCGAAATG
  1. EST: expressed sequence tag. SSR: single sequence repeat. LG: linkage group.