Skip to main content

Table 1 Primers

From: Selection of reference genes for quantitative real-time PCR in equine in vivo and fresh and frozen-thawed in vitro blastocysts

Gene GenBank accession number Sequence Amplicon size (bp) Ta (°C) RTprimerDB ID Cq range
ACTB AF035774 CCAGCACGATGAAGATCAAG
GTGGACAATGAGGCCAGAAT
88 60 7848 16.3-23.8
GAPDH XM_001496020.1 CAGAACATCATCCCTGCTTC
ATGCCTGCTTCACCACCTTC
187 59 7849 14.2-24.5
H2A/I XM_001497311.2 ATATTCAGGCCGTGCTGCT
TTTGGGTTTCAAAGCGTTTC
105 60 * 23.5-37.3
HPRT1 AY372182 GGCAAAACAATGCAAACCTT
CAAGGGCATATCCTACGACAA
163 57 7850 17.6-25.8
RPL32 XM_001492042.2 AGCCATCTACTCGGCGTCA
TCCAATGCCTCTGGGTTTC
149 60 * 16.8-25.9
SDHA XM_001490889 TCCATCGCATAAGAGCAAAG
GGTGGAACTGAACGAACTCC
159 59 7851 20.7-33.3
TUBA4A XM_001491910.2 GCCCTACAACTCCATCCTGA
ATGGCTTCATTGTCCACCA
78 60 * 16.6-27.9
UBC AF506969 GCAAGACCATCACCCTGGA
CTAACAGCCACCCCTGAGAC
206 60 7874 15.5-23.7
  1. For each reference gene, the NCBI GenBank accession number, the sequence of both forward and reverse primer, the size of the amplicon and the optimal primer annealing temperature are listed. The RTPrimerDB ID http://rtprimerdb.org/ is also reported, except for the primers for which there is not yet an official reference sequence available in the database (*).