Skip to main content

Table 1 Adapter and primer sequences used in AFLP.

From: Validation of phylogenetic signals in amplified fragment length data: testing the utility and reliability in closely related taxa

Adapter Sequence
Eco RI-Adapter 5'-CTCGTAGACTGCGTACCAATTC-3'
3'CATCTGACGCATGGTTAAG-5'
 
Mse I-Adapter 5'-GACGATGAGTCCTGAGTAA-3'
3'-TACTCAGGACTCATT-5'
 
Snails Eco RI Sequence (5'-3') Mse l Sequence (5'-3')
Preselective Primer 1 CTCGTAGACTGCGTACCAATTCGACCA GACGATGAGTCCTGAGTAAGACCG
Preselective Primer 2 CTCGTAGACTGCGTACCAATTCGACCA GACGATGAGTCCTGAGTAAGACGC
Preselective Primer 3 CTCGTAGACTGCGTACCAATTCGACCT GACGATGAGTCCTGAGTAAGACCG
Preselective Primer 4 CTCGTAGACTGCGTACCAATTCGACCT GACGATGAGTCCTGAGTAAGACGC
Selective Primer 1 CTCGTAGACTGCGTACCAATTCGACCAA GACGATGAGTCCTGAGTAAGACCG
Selective Primer 2 CTCGTAGACTGCGTACCAATTCGACCAA GACGATGAGTCCTGAGTAAGACGC
Selective Primer 3 CTCGTAGACTGCGTACCAATTCGACCTG GACGATGAGTCCTGAGTAAGACCG
Selective Primer 4 CTCGTAGACTGCGTACCAATTCGACCTG GACGATGAGTCCTGAGTAAGACGC
Salamanders   
Preselective Primer 1 CTCGTAGACTGCGTACCAATTCGACCA GACGATGAGTCCTGAGTAAGACGA
Preselective Primer 2 CTCGTAGACTGCGTACCAATTCGACCA GACGATGAGTCCTGAGTAAGACGC
Preselective Primer 3 CTCGTAGACTGCGTACCAATTCGACCA GACGATGAGTCCTGAGTAAGACCG
Preselective Primer 4 CTCGTAGACTGCGTACCAATTCGACAC * GACGATGAGTCCTGAGTAAGACCA *
Selective Primer 1 CTCGTAGACTGCGTACCAATTCGACCAA GACGATGAGTCCTGAGTAAGACCA
Selective Primer 2 CTCGTAGACTGCGTACCAATTCGACCAA GACGATGAGTCCTGAGTAAGACGC
Selective Primer 3 CTCGTAGACTGCGTACCAATTCGACCAA GACGATGAGTCCTGAGTAAGACCG
Selective Primer 4 CTCGTAGACTGCGTACCAATTCGACACC * GACGATGAGTCCTGAGTAAGACCA *
  1. Adapter and preselective and selective primer sequences for the rare cutter, Eco RI and the frequent cutter, Mse I. Black text indicates the core sequence of either of the adapter, Eco RI or Mse I sequences. Black Bold text indicates the restriction portion of the adapter sequence. Black Bold Italicized text indicates the preselective or selective primer sequence. The * indicates a primer combination used in the salamander portion of the study, but the results are not presented here.