Skip to main content

Table 6 Primer and probe sequences for custom made Sequenom SNP genotyping assay for NOD1

From: Nucleotide-binding oligomerization domain containing 1 (NOD1) haplotypes and single nucleotide polymorphisms modify susceptibility to inflammatory bowel diseases in a New Zealand caucasian population: a case-control study

Primer SNP_ID Probe Sequences
Forward primer rs2075818 ACGTTGGATGCACTCACATCCGCAATACTC
  rs2075822 ACGTTGGATGAAGGGGAGCAACAGGTGGGC
  rs2907748 ACGTTGGATGAGGGTGGGCTCCTCTACAG
Reverse primer rs2075818 ACGTTGGATGGGCAGGCACACACAATCTCC
  rs2075822 ACGTTGGATGAAGGGCCATGGTCATGAGTC
  rs2907748 ACGTTGGATGACAGAAGGTCAATGGGACTC
Extend primer rs2075818 TAAGAATGACTACTTCTCGGC
  rs2075822 GGGCATCGGGAATGGCA
  rs2907748 GTGGGCTCCTCTACAGGTAGCT