Table 1 PCR primers, amplicon sizes and function of genes selected for qRT-PCR analysis.
From: Characterization of an Atlantic cod (Gadus morhua) embryonic stem cell cDNA library
Gene | Accession no. | Forward primer (5' – 3') | Reverse primer (5' – 3') | Size (bp) | Function (from mammalian homologs) |
|---|---|---|---|---|---|
BMI1 polycomb ring finger oncogene | EX738556 | CAGGCGGCAAACAAGAGGTA | ATGACTTCAACCTGGTAGGTGTTG | 113 | Component of the Polycomb group (PcG) multiprotein PRC1 complex, a complex required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. In the PRC1 complex, it is required to stimulate the E3 ubiquitin-protein ligase activity of RNF2/RING2 |
One-eyed pinhead protein | EX737753 | AGAACGGAGGGACGTGCAT | TCTGAACCCACTCCCCATGA | 126 | Involved in the correct establishment of the left-right axis. May play a role in mesoderm and/or neural patterning during gastrulation |
Ovary-expressed homeobox protein (shows similarity to Nanog) | EX736873 | AGCCCAATCGGGACTCACTT | TTCTTGGCATTGTAGTGCTCAGA | 117 | Transcription regulator involved in inner cell mass and embryonic stem (ES) cells proliferation and self-renewal. Imposes pluripotency on ES cells and prevents their differentiation towards extraembryonic endoderm and trophectoderm lineages. Blocks bone morphogenetic protein-induced mesoderm differentiation of ES cells by physically interacting with SMAD1 and interfering with the recruitment of coactivators to the active SMAD transcriptional complexes (by similarity). Acts as a transcriptional activator or repressor (by similarity). Binds optimally to the DNA consensus sequence 5'-[CG] [GA] [CG]C [GC]ATTAN [GC]-3' (by similarity). When overexpressed, promotes cells to enter into S phase and proliferation (by similarity) |
Pre-mRNA-processing factor 19 (PRP19) | EX738721 | GGACCGACCCGATGAATG | CCTGGAGGGACTTGAGAATGG | 126 | Plays a role in DNA double-strand break (DSB) repair and pre-mRNA splicing reaction. Binds double-stranded DNA in a sequence-nonspecific manner. Acts as a structural component of the nuclear framework. May also serve as a support for spliceosome binding and activity. Essential for spliceosome assembly in a oligomerization-dependent manner and might also be important for spliceosome stability. May have E3 ubiquitin ligase activity. The PSO4 complex is required in the DNA interstrand cross-links (ICLs) repair process. Overexpression of PRPF19 might extend the cellular life span by increasing the resistance to stress or by improving the DNA repair capacity of the cells |