Skip to main content

Table 4 List of primers for the 12 conserved SSRs used for wet-lab experiment

From: Orthology between genomes of Brachypodium, wheat and rice

Brachypodium contig Id. Motif Primer sequence 5'-3' Tm (°C) Product size (bp) Gene class
BDEST01P1_Contig9 (gct)5 L GCCTATGTTTCCGCAGAGAG
R CCAGGCAAGAAGTTCCTGAG
59.98 203 Formate dehydrogenase
BDEST01P1_Contig1223 (cca)4 L AGCCAACTCTTGCAGCAAAT
R TGTTGCTCCCTCCTTTTGAT
59.67 207 Endo-1,4-beta-glucanase Cel1
BDEST01P1_Contig1335 (tca)4 L GACGAGAGGTTGTGTTGGTG
R ACAGGACACCGTCAGAGGAA
60.71 239 Putative uncharac-terized protein
BDEST01P1_Contig1574 (cgc)6 L CAAAACCCTAGCTGCCCTTC
R TGCCAGTGCTTCTTGAAATG
59.99 123 Putative 60S ribos-omal protein L13E
BDEST01P1_Contig2089 (ggc)4 L GCTCTTCTCGCCCCTCTACT
R CTCCATCTGGAAATCGCAGT
60.22 200 Hypothetical protein
BDEST01P1_Contig2416 (tcaaga)2 L CCGCACCTCAAGGACTACA R TCGGAGGAGATCTTGGTGAG 60.34 194 Succinate dehydrogenase
BDEST01P1_Contig2648 (ggt)4 L AAACCACTTGCCAAAACACC
R GCTGCGGTTCTCCATGAC
60.37 248 Putative uncharac-terized protein
BDEST01P1_Contig3139 (tcg)4 L AGTCACCAAGGTCGTCAAGG
R CCTTCGCTGCTCCATAGTCT
59.6 224 Putative ribosomal protein
BDEST01P1_Contig3247 (tggtgc)2 L AGTTGGAATGAGGGCATCAG
R TTCAAGGCTCTCGAGTAGGG
59.57 214 Putative uncharac-terized protein
BDEST01P1_Contig3321 (gctcgc)2/N36/(ggc)4 L CACTTCGAGTTTCCCGTCAT
R TTTTGCAGTGTCCACACCAT
60.01 244 Protein disulfide isomerase 2 precursor
BDEST01P1_Contig3721 (gct)4 L GGACTACTTTGGGGCTCACA
R GGATTCATAACTGGCAACCA
59.44 180 Cytosolic 6-phosphogluconate dehydrogenase
BDEST01P1_Contig3747 (tcgcca)2 L AGGTCAACTCGGTCAACGAC
R AGGTCAGCCCGTTGTTGTAG
60.17 192 Phenylalanine ammonia-lyase