Skip to main content

Table 2 Sub-cluster names (from the PigEST database) and primer sequences of experimentally verified splice variants.

From: A study of alternative splicing in the pig

Gene symbol Sub-cluster name Forward primer (5'→3') Reverse primer (5'→3') Amplicon length (bp)
IGF2 Ss1.1-Utr1-UTR01C050081.5SS AGCCCACAGCGATTCCAA AGTCTCACTGGGGCGGTAAG 110
  Ss1.1-Liv1-LVR010049B06.5SS CCGGCTTCCAGATTCCAA AGTCTCACTGGGGCGGTAAG 143
EIF4E2 Ss1.1-Pig3-SRG8020J01.3SS CCGGTTTCAGGAGGACATTA GAAAGCTTGAATTGTCCTTGATG 164
  Ss1.1-Tes1-TES01A030013.5S CCGGTTTCAGGAGGACATTA ACTCCTCCCAGGCCTTGAT 161
RBM4 Ss1.1-Lng1-LNG010007H10.5SS TCGGCATTGCGCGGCTGT CTCGAACAGTGAGCGGATCT 94
  Ss1.1-Utr1-UTR010079B01.5S GATTTTCGTGCGGGCTGT CTCGAACAGTGAGCGGATCT 94
  Ss1.1-Lng1-LNG010007H10.5SS CATCAGAGGCCTTGACAACA CGGCAACAGGTGTCGATAG 101
  .1-Thy1-THY010092E11.5SS TCGTGAAAGATTATGCCTTCG CACACACATCCCACCTTGAA 101
  Ss1.1-Utr1-UTR010079B01.5SS TCGTGAAAGATTATGCCTTCG CTCTTTCCCGCACCGATAGC 124
ANAPC11 Ss1.1-Pig4-TMW8023A04.5SS GTGGGCCTTGCAGGAGTT GAGCCACTTGAGGATGCAGT 246
  Ss1.1-rnca27b_a11.5S CCGCGGTCGTTTATATACCT GAGCCACTTGAGGATGCAGT 276
  Ss1.1-Pig3-SRG8012J07.3S TGGCTCCCAAGTGCTGTAG GAGCCACTTGAGGATGCAGT 267
ATP5S Ss1.1-ruio31_j9.5SS TCCCTTCGACGCTATCAAAT GATGCGTTCATGATCCACTTT 144
  Ss1.1-Mixn-0026b16.5SS ACCAAGTGGCAAATCAAATG GATGCGTTCATGATCCACTTT 143
HNRPLL Ss1.1-rret19_c4.5S GATAAGAGTTCCCAATGGTTCC GGTAAACAAATTCTAACATGCTCTTC 101
  Ss1.1-rpbfe0126_n23.5S TGAAAGTTTGATGAAGGGAACT GGTAAACAAATTCTAACATGCTCTTC 136
PPP3CC Ss1.1-LyN1-MLN01A040100.5 GATGAAATTGAAGGAGGCACT TCCCGAAGAATTGAAAAGACC 98
  Ss1.1-Mixn-0001e03.5S AAGCTATCAGAAAGGAGGCACT TCCCGAAGAATTGAAAAGACC 99
CEP27 1Ss1.1-Liv1-LVRM10031B03.5SS CTAAAGAAAATGAGCACAGC TCTGTTGTTCTCGCCACTTG 97
  2Ss1.1-rsug28_c19.5S GCTGTTTATCACAGAGCACAGC TCTGTTGTTCTCGCCACTTG 99
  3Ss1.1-Pig4-TMW8033B03.3S CCTTCATTTTTGGAGCACAG TCTGTTGTTCTCGCCACTTG 98
BSCL2 Ss1.1-Thy1-THY010012C06.5 GGTGTGCAGAGACCAGATCA GGTTCAGGCCTTGAGTTCCT 117
  Ss1.1-Spl1-SPL010003H07.5S GCTGCTCGCTCTGAGTCC GGTTCAGGCCTTGAGTTCCT 111
AUH Ss1.1-Ova1-OVR010018B04.5SS CTACAGCTCTGAGGCGAAGA CACCACAATTCCTCGGTTCT 76
  Ss1.1-Liv1-LVR010068B01.5S GGCAATTATTCCTGGTGGAG TCAAATGTTGCCTTTTCAGC 107
  Ss1.1-Pig3-SRG8009K09.3S TGTCTCCTGTGCTGCAGTATG TGTGTGAGGGTACATGTGTGAA 108