Skip to main content

Table 1 Genome-specific primer sets for the three homoeologous Wx and SSII genes.

From: Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L.) as examples

Primer name Primer sequence (5'→3') Tm (°C) Size (bp) Chromosomal location
Wx-7A-F1 GTAAGCTTGCGCCACTGC    
Wx-7A-R1a GGATGCAGAATGCCACCTA 60 950 7A
Wx-7A-F2 CGCTCTGCATATCAATTTTGC    
Wx-7A-R2a ATATGCAAAGGAGGTGAGGAAC 60 1038 7A
Wx-7A-F3 CTGGTACGATCGACCGACAT    
Wx-7A-R3 CGGCCCTTCACTCTTAGTTG 60 750 7A
Wx-4A-F1 AGCTAGCACCACTGTCTTCTGA    
Wx-4A-R1 GGCCGTCCTATAGATGCCAC 60 854 4A
Wx-4A-F2 TCAACAACACCCAGCAGCTA    
Wx-4A-R2 GGTTGGGGTCGATGACGTA 60 943 4A
Wx-4A-F3 CCACACACCCACACAAAGAT    
Wx-4A-R3 TTTACACAAGGGATCGACGAG 60 731 4A
Wx-7D-F1 CCATGGCCGTAAGCTAGAC    
Wx-7D-R1 CGCAAAATTGATATGCCTGTT 60 978 7D
Wx-7D-F2a AACTACCAGTCCAATGGCATCTAC    
Wx-7D-R2a GCTCGGGAATTTCTCCTCAAT 60 938 7D
Wx-7D-F3 CCAGATCGTTCTCCTGGTACA    
Wx-7D-R3a CTCGCTCCCCTCGACA 60 861 7D
SSII-7A-F2 CCCAGAACAGAGTACCAGTGAAC    
SSII-7A-R2 CGGATCTACAGGGCAGGTAA 60 953 7A
SSII-7A-F3 GCAGTCGGATTTCACAAATAAGG    
SSII-7A-R3a CCTGACGGTGTCGGAAGAT 60 883 7A
SSII-7A-F4a AGCGAAAATGCAATCAAAGG    
SSII-7A-R4a TTTGGGTATGAGGGGGAAAT 60 1657 7A
SSII-7A-F5a TGCACCATCGCTCGAAGT    
SSII-7A-R5 CGTTGATGTGACACCATATCCT 60 983 7A
SSII-7B-F2 CTGTCAGCGACGTGGAACT    
SSII-7B-R2 TGCATTGAAATGAAAGCTTGAC 60 947 7B
SSII-7B-F3a GCAGTCGGATTTCACAAAGAAC    
SSII-7B-R3 GGTCAGTAGGCCTTGGCTTG 60 973 7B
SSII-7B-F4a CATTGACGCTCCTCTCTTCC    
SSII-7B-R4a TACTCCCACTATGGTTAGCCTTACA 60 1596 7B
SSII-7B-F5 ACAACTTCATGGGAACAAGGTT    
SSII-7B-R5 CTCAGACCTGACGGAGATGG 60 949 7B
SSII-7D-F2a GTCAGCGACGTGGAACAA    
SSII-7D-R2a CGCGAAACTAGCTCCCAATC 60 1053 7D
SSII-7D-F3 AGCCAGATTTCACAAAGAAGGA    
SSII-7D-R3 AGTCAGTAGGCCTTGGCTTG 60 973 7D
SSII-7D-F4 CTCTCTTCCGACACCGTCA    
SSII-7D-R4 GGAGAAGGAGAGGAGAAGTTGG 60 1654 7D
SSII-7D-F5 TGCGTCGCCTCATAGAGC    
SSII-7D-R5 GCACAAGCAACTGACCTCAC 60 987 7D
  1. The forward and reverse primer pairs are listed together for each fragment amplified.