Skip to main content

Table 1 Characteristics of microsatellite loci isolated from M. acuminata Calcutta 4 and polymorphic across 21 M. acuminata accessions.

From: Characterization of novel microsatellite markers in Musa acuminata subsp. burmannicoides, var. Calcutta 4

Locus name BAC consensus sequence ID GenBank Accession no. Repeat Array Primer Sequence (5' - 3') Obtained allele size range (bp) Tm(oC) used N a H E H O HWE P value PIC
MABN01 MA4_008L021 AC186748 (AG)12 F: CCACTGAAGCTGAAAGGAGG 500-540 56 3 0.667828 0.875000 0.021000* 0.577
     R: GGATTGTAGGTGACGGGAGA   56      
MABN03 MA4_008L021 AC186748 (TG)10 F: TGGTTGTATGTTTGCTGGGA 500-545 60 3 0.593590 0.850000 0.013500* 0.504
     R: CAAAGTGCTGGCATGAGAAA   60      
MABN06 MA4_008L021 AC186748 (ATAC)3 F: GCAACCATCAACCAAAAACC 344-360 58 3 0.444872 0.200000 0.013500* 0.365
     R: TTTGCAAGAAAATCGTGCTG   58      
MABN07 MA4_008L021 AC186748 (ATA)6 F: TTTTGATCATCATATGGGTCG 500-540 60 2 0.344948 0.428571 0.512000 0.258
     R: AGAGGGAGAGCCAAAGTGGT   60      
MABN08 MA4_008L021 AC186748 (GA)13 F: TTACCGTAAACGGAGCCAAC 260-290 58 3 0.637631 1.000000 0.000000* 0.544
     R: GAAATCGAGGAAAACCGACA   58      
MABN13 MA4_111B014 AC186954 (CA)6 F: CCTCAACGAAGCATACAGCA 210-240 58 2 0.450980 0.647059 0.106500 0.351
     R: CAGTCTGGGCTGACACAGAA   58      
MABN15 MA4_111B014 AC186954 (ATTTT)3 F: CCAACTTCCATTTGGCTTTT 490-520 58 2 0.315912 0.380952 1.000000 0.258
     R: CGCAGGCGACTTCTTACAGT   58      
MABN17 MA4_111B014 AC186954 (TCT)14 F: CCCATGCAACTACAACAACG 200-245 60 4 0.732804 1.000000 0.125000 0.659
     R: GGAACCACGTGTCCTGATCT   60      
MABN19 MA4_106O017 AC186747 (TTTAT)3 F: CTCCACCGCTGCAAATTAT 330-380 60 4 0.750794 0.944444 0.003000* 0.681
     R: TTCATTTGATTGGAAAGTGGAA   60      
MABN20 MA4_106O017 AC186747 (AC)7 F: AAGAAGTGCAACAGATGGGC 344-380 56 3 0.537179 0.550000 0.727500 0.454
     R: GCCAAAGGAATCATGCTGTT   56      
MABN22 MA4_106O017 AC186747 (AG)6 F: GTCGCAGAGATCAAGGAACC 490-510 58 2 0.507549 0.619048 0.392000 0.373
     R: GGACCTCCTATGTTTGCTGC   58      
MABN23 MA4_106O017 AC186747 (TTA)4 F: TCGATCATTTGGCATCACAT 350-500 60 4 0.723577 0.952381 0.015500* 0.641
     R: CCAGGTAGCGAAGACGAGAC   60      
MABN25 MA4_106O017 AC186747 (TAT)9 F: TTTCATGATTTGAGGAGCCC 380-410 58 2 0.462304 0.684211 0.049500* 0.348
     R: CCCCACAAGTATGTTCCCAC   58      
MABN26 MA4_106O017 AC186747 (CT)24 F: GTGGGAACATACTTGTGGGG 375-395 58 2 0.493612 0.047619 0.000000* 0.359
     R: ACGGAAAACCACAAGCAATC   58      
MABN27 MA4_106O017 AC186747 (GAA)4 F: GGATGCAAAGACGGACAAAT 470-520 58 3 0.667828 0.714286 0.000000* 0.575
     R: TAATGGCTTTGCAACTGCTG   58      
MABN28 MA4_106O017 AC186747 (GA)23 F: TGGAGGTCTCAACCAAAACC 390-410 60 2 0.480769 0.550000 0.639500 0.367
     R: AGATTGGCTACTGTGGGTGG   60      
MABN29 MA4_106O017 AC186747 (GAT)5 F: ACCAGCCACTGGAATCAAAC 350-385 60 3 0.600000 0.866667 0.069000 0.506
     R: GTCTGCTGAAGAGCCAAACC   60      
MABN30 MA4_106O017 AC186747 (ATTTT)3 F: CAGCCGTTGATGTTCAAATG 360-380 60 2 0.387097 1.000000 0.000500* 0.321
     R: CGTTACGGTGGATCGTCTTT   60      
MABN34 MA4_106O017 AC186747 (CT)18 F: TAGGTGAGAATGGGACGGAG 330-355 58 3 0.661451 0.368421 0.000000* 0.571
     R: CAGTAGCAGCAACCTGGTGA   58      
MABN35 MA4_106O017 AC186747 (CT)14 F: CTGTCACCAGGTTGCTGCTA 270-320 56 4 0.664103 0.450000 0.005500* 0.569
     R: CTTCCTTGGACCTTTCATCG   56      
  1. Tm, annealing temperature used; Na, number of alleles per locus observed; HE, expected heterozygosity under Hardy-Weinberg expectations; HO, observed heterozygosity; H-W, P value for deviation from Hardy-Weinberg equilibrium, with *significant departure (P < 0.05) from HW equilibrium; PIC, Polymorphism Information Content