Skip to main content

Table 1 The set of synthetic oligonucleotide probes used in the MLPA assay.

From: A simple way to evaluate self-designed probes for tumor specific Multiplex Ligation-dependent Probe Amplification (MLPA)

Probe name Location Length (bp) Left probe hybridizing sequence Right probe hybridizing sequence
ARX Xp21.3 83 CGAATGCCGGGCTGATGAAAG CTGGGTGTCGGAACACTGCC
AFAP1L1a 5q33.1 90 CCTACACTAACACATGATGAAAACC TCAATATGTCCTCAGGTGGTACC
ACTR1A 10q24.32 102 GGATGAGTTAATTCACACAGCTTTG TCAGAGCCCTCATGCAGCCTCTTGTAAGCAGATAG
AFAP1L1b 5q33.1 114 GAGACAAGACCTGATCATCTGATCACACTT GTGCCAACTTGATTCATATTGGGCATTACTAACAACCCCTGG
CFL2 14q13.2 132 ctgacCGTGCTGCCATATCACTAAAATAGGCTTGCCAAGG CAGGTGAGGTGTATGAATGCTCAAGCCTCACAGAACTGCAATCAAGTGCC
P1 1q25.3 106 gctaCTCCAGAGCAAATAAGCATGG ACCTCAAGAATGAATTGATGTACCAGTTGGAgactgact
P2 1q25.3 122 CAAGAAGACCAGGTCAACTGCAAAACTGGT CTCTAAGGCCCATAGGATCTTTGAGGAGTTTGTGGATGTGCAGGCTCCAC
P3 1q25.3 127 gactgactgactCCGTAAATGAACGTATGCTGAACATG ATCCGTCAGATCTCTAGACCCTCAGCTgactgactgactgactgact
Fr. 14 1q25.3 101 GAGGACGTGAACCAGGACCGTAAGGA CATGAGCCAGAGCAGTGGTAGCGAGGATGGAGG
Fr. 31 1q25.3 107 TGGGCAGATTCCTTTGATGTGCTTC TCTCTCATAAGTGTAAGTAGAATTCAGGTCGTATCATGAC
Fr. 32 1q25.3 119 gactGACCTGCGTTCTTGATTTTGACTCAGCG TTGTTACTAAGTAGTTGGGTGGTCTTGACAGAAACTCgactgact
  1. Upper case correspond to the left and right hybridizing sequence of each probe, whereas lower case correspond to the stuffer sequences used to increase the size of the probe; underlined probes concern the reference probes analyzed in this study.