Skip to main content

Table 1 Example PCR Primer Pairs Designed After Submitting TCF7L2

From: Optimus Primer: A PCR enrichment primer design program for next-generation sequencing of human exonic regions

Region Name Forward Primer Reverse Primer
TCF7L2_chr10_exon1-3_1 CTGTTTATTTATGCACACGTCACTG gTACTCACCTTCTTCCAAACTTTCC
TCF7L2_chr10_exon1-3_2 GATTCTTTTTCTCCCCCTTCTC AGCCAGCAATCTCCACTAGAAAG
TCF7L2_chr10_exon4_1 TCCCTGTATGCTTATTGAATAGGTG CCCAGAAAAGAAGTCATGGAATAAC
TCF7L2_chr10_exon5_1 GGCTAGTTGTTCTGCATTTACTTTC AGCTCCAAAATAAGGAGGCAGTTAG
TCF7L2_chr10_exon6_1 AATAGGAGAGTTCTGATTTGTGCTG GACTTATTCCACATTTTGTCTCTCC
TCF7L2_chr10_exon7_1 CATCTTAGAAAATCCAGGTGAGAGG AACAACTGGGATAAAAAGGGGATG
TCF7L2_chr10_exon8_1 ATGAGATGAAACCTACCAACAACTC TGTTGTTCAGAGTACAGATCACTGG
TCF7L2_chr10_exon9_1 CTTACTGTGCAGAGAGAACTTTTCC ATTAGCGACTAAAACATACTGCTGC
TCF7L2_chr10_exon10-12_1 ACGATTTACACAGCTTTCTGTCTTC CTATGTCATTCTGTCATTTGCTCAC
TCF7L2_chr10_exon10-12_2 CTGAGTGCACGTTGAAAGAAAG AGAGAGGACTAGGCAGATCCTGTAG
TCF7L2_chr10_exon13-14_1 CAGACACTCTTCTCACATCTGTTTC GGAGGTTTATTACTGAATTCCTTCC
TCF7L2_chr10_exon15-16_1 CTCGCTTCTCTCTTGAACTCATTC CTTCTCCATGTGTCTCGACTCTAAG
TCF7L2_chr10_exon17_1 TATTCACAGATAACTCTCTCCCCTG TCTATTAAGTGTTGAGTAGCGTCCC
TCF7L2_chr10_exon17_2 ACATCTGGTTTTTAAACCGTAAGGG GAGCATAAAACGGAACAGTAACATC
TCF7L2_chr10_exon17_3 CATATTACATACGAGTAGGCAGCAG CGATACTGTGGTCACCTTAAGAAAC
  1. After having only submitted the gene name (TCF7L2) Optimus Primer was able to successfully design PCR primers to amplify all exons (see figure 1 for amplicons position). Note that exon in close proximity to each other were merged into single amplicons (exons 1-3 for example) and that large exons were divided into several amplicons to maintain consistent amplicons size (exon 17 for example).