Skip to main content

Table 1 Mitochondrial, chloroplast, and nuclear genes derived probes, and associated primer sequences used for the characterization of the CinS2S2 and CinS1S4 libraries.

From: Construction and characterization of two BAC libraries representing a deep-coverage of the genome of chicory (Cichorium intybus L., Asteraceae)

Probea Description Accession numbersb Primer sequences (5' → 3') Tm (°C) Size (bp)
atpA F1-F0 ATP synthase, subunit alpha X80469, X51422, AF034118, X52838 L: gatcttgtcaagcgcactgg
R: agtaatgcctgagtcgcagc
66
64
1000
atp9 F1-F0 ATP synthase, subunit 9 X51895, DQ539624 L: aataggggccggagctgc
R: gaaaggccatcattggggc
69
69
184
cob Apocytochrome b X98362, EF674047, EF674014, DQ916732 L: gagttatagcagtcctaggg
R: ctagtagtaagcaatccgcc
55
58
697
cox2 Cytochrome c oxydase, subunit 2 AJ414385, EF547230, DQ004553, EF488904 L: atttcaagacgcagcaacacc
R: gtactacctcgtccattgag
65
56
264
matK Maturase K AJ633132 L: tggttcaggctcttcgctattgg
R: cgtcccttttgaagcaagaattg
70
68
398
ndhF NADH dehydrogenase AY504736 L: tacttgtattgattctatttctttg
R: caacaagattaaagattaaaaaag
55
55
581
rbcL Ribulose 1,5-biphosphate carboxylase/oxygenase, large subunit L13652 L: ttgccgagataatggcctac
R: ccaaagatctcggtcagagc
64
64
336
trnL-trnF Intergenic spacer tRNA-Leu (trnL)-tRNA-Phe (trnF) genes FJ490769 L: ggttcaagtccctctatcccc
R: ctaccagctgagctatcccg
65
64
397
CiAGP Arabinogalactan protein DT212458 L: aaaccaaccaagactttgaccacg
R: cccccttaagtttccacaaattac
58
64
418
CiSTM SHOOT MERSISTEMLESS transcription factor GU189066 L: gtaggtacatcatgtttgatggggtttggag
R: ccctaccttttggcaattca
73
64
344
  1. aatpA, atp9, cob and cox2 correspond to mitochondrial sequences, matK, ndhF, rbcL and trnL-trnF to chloroplast sequences, and CiAGP and CiSTM to cDNA sequences.bMultiple accession numbers for a probe indicate that primer pairs were designed from the consensus sequence of these accessions.