Skip to main content

Table 1 List of primer sequences used and/or developed in this study for PCR and sequencing. Standard IUB codes are used for degenerate primers.

From: Towards the simplification of MHC typing protocols: targeting classical MHC class II genes in a passerine, the pied flycatcher Ficedula hypoleuca

Primer Name Sequence (5'-3') reference
326 GAGTGYCAYTAYYTNAAYGGYAC Ekblom et al. (2003)
325 GTAGTTGTGNCKGCAGTANSTGTCCAC Ekblom et al. (2003)
MHC05 CGTRCTGGTGGCACTGGTGGYGCT Miller and Lambert (2004)
RapEx3CR CAGGCTGRCGTGCTCCAC Alcaide et al. (2007)
MHC-F1 GAGTGTYVCTTCATTAACGGCAC Anmarkrud et al. 2010
MHC-R1 CKCGTAGTTGTGCCGGCA Anmarkrud et al. 2010
MHCIIFihy-I1F CCTGYACAAACAGRGKTKTTCC This study
MHCIIFihy-I2R GCTCTGCCCCACGCTCAC This study
MHCIIFihy-pE2R ACCTCACCTTCTCCGTGC This study
MHCIIFihy-pE2F AAYGGCACGGAGAAGGTG This study
MHCIIFihy-lwE2F CATTAAYGGCACCAGCCGG This study
MHCIIFihy-psE2R TCCTCTCCACCAACCTCACGCA This study
MHCIIFihy-E2CF CCGTGTCCTGCACACACAGC This study
MHCIIFihy-E2CR GGGACASGCTCTGCCCCG This study
MHCIIPas-E2iF GAGTGTYACTTCATTAACGGCAC This study
MHCIIPas-E2iR CYNGTAGTTGTGNCGGCAG This study