Skip to main content

Table 2 Primers used in this work

From: Stage-specific fluorescence intensity of GFP and mCherry during sporulation In Bacillus Subtilis

Plasmid Primer Sequence (5'-3')
pEU2 rpoB F GGGTTCCTGGCGCGAGCGCAGCAGCCTCTTGGCGGTAAAGCGCAATTTGG
rpoB R TTGGGCTGGCGCGAGCTTCTTTTGTTACTACATCGCGTTCAACGTCTGC
pEU13 YloH F GGGTTCCTGGCGCGAGCTTAGATCCGTCAATTGATTCTTTAATG
YloH R TTGGGCTGGCGCGAGCTTCGCGGTCTTCCTTTTCAAACG
pEU14 YkzG F GGGTTCCTGGCGCGAGCATTTATAAGGTATTTTATCAAGAGAAGGCTG
YkzG R TTGGGCTGGCGCGAGCTAACTCCAATACTTTAAAATTTTCGCTCTG
pEU16 RpoE F GGGTTCCTGGCGCGAGCCGCATCTTTGCTCGGCGTG
RpoE R TTGGGCTGGCGCGAGCTTTAATTTCCTCTTCTTCATCATCATAGTC
pEU21 RpoC F GGGTTCCTGGCGCGAGCCGTAGAAGTAATGGTTCGCCAG
RpoC R TTGGGCTGGCGCGAGCTTCAACCGGGACCATATCGTC
pEU37 NusA F GGGTTCCTGGCGCGAGCCACAGATGATCCTGACGTTGATC
NusA R TTGGGCTGGCGCGAGCTTCATCCGATTCAGCAGTTTCAGG
pNG670 NusA mCherry F AAGGGGGGAGACCTCGAG ATGAGCAGTGAA (Xho I)
NusA mCherry R ACCTAAAGTCACGAATTC TTCATCCGATTC (EcoR I)
pNG677 YkzG mCherry F AGATTTGGTACC ATTTATAAGGT (Acc 651)
YkzG mCherry R TCATACCTCGAG TAACTCCAATA (Xho I)
pNG735 pETmCherry F TTTTTTCATATG GTGAGCAAGGGCGAGG (Nde I)
pETmCherry R TTTTTTGAATTC CTACTTGTACAGCTCGTCC (EcoR I)
  1. Restriction sites underlined