Skip to main content

Advertisement

Table 2 Aberrations in exon and intron, and only present in CLL

From: Evidences showing wide presence of small genomic aberrations in chronic lymphocytic leukemia

Ditag Full-length (bp)* CLL Sample** Chr. Location Aberration Gene
   1 2 3 4 5 6 7 8     Exon Intron
A. Aberrations affecting exon and intron              
AAGCTTACCCTCTGGACGCCTGTATGAAGCTT 353 + - - - - - - - 17q11.2 24093147-24093483 Insertion NEK8  
  268 + + - - - - - - 19p13.2 10331021-10331266 Insertion   TYK2
AAGCTTCGGCCTATAGACAACCTAACAAGCTT 434 + + + + + + + - 21q22.12 35949034-35949460 Base change RUNX1  
AAGCTTCCGGTCGGCTTCGCAGTAGAAAGCTT 410 - + - + - - - - 11p15.5 1084558-1084956 Insertion MUC2 MUC2
AAGCTTGAGGGTGGAGTTCCTTCTGTAAGCTT 181 - + + - - - - - 2p11.2 87573183-87573358 Base change, insertion   BC070201
AAGCTTGGCCAGAGACAGGCATCATGAAGCTT 116 + - - - - - - - 10q22.1 73213666-73213767 Base change   CDH23
AAGCTTGTGGACCACCGCTGTGAGTCAAGCTT 300 + + + + + - + + 20p12.3 6033711-6034006 Base change   FERMT1
AAGCTTCATATGAGGATCAAAAACGAAAGCTT 283 + + - + + + - - 3p14.2 61015245-61015527 Base change   FHIT
AAGCTTCTTTGTGATGCTCAGACATGAAGCTT 332 - + - - - + - - 11q23.3 120263755-120264067 Base change   GRIK4
AAGCTTAGATCAGTGAGCCTACGGCGAAGCTT 605 + + + + + + - + 16q22.2 69601759-69602345 Base change   HYDIN
AAGCTTCGCCGTGGGCTCACTGATCTAAGCTT 614 + + + - + + + + 16q22.2 69601760-69602350 Base change, insertion   HYDIN
AAGCTTGCTGAACGCACCTGCGTGGAAAGCTT 448 + - + - - - + + 5q22.2 112671099-112671541 Base change, insertion   MCC
AAGCTTGCTTCTTTGCTGATACTGGCAAGCTT 582 - + + - - + - - 12q24.31 123563471-123564048 Base change, insertion   NCOR2
AAGCTTGGCGTCAATCCACACCAAAGAAGCTT 349 - - - - + + - - 5q33.1 149870225-149870557 Insertion   NDST1
  1306 - - - + - + - - 8q22.2 99587880-99589168 Base change, insertion   STK3
AAGCTTGAAATAAGTGCTGCATCCTGAAGCTT 163 - + + - + - - - 2q32.1 182858618-182858771 Base change, insertion   PDE1A
AAGCTTTCCTAGGGAGCTGGGTGGTGAAGCTT 638 - - - + + - - - 17q25.1 68849242-68849864 Insertion   SDK2
  211 + - - - - - - - 9q34.11 129692280-129692481 Base change   ST6GALNAC6
AAGCTTGCAGAAGGGGAGCCAGGGTGAAGCTT 312 - - + - - - + - 2p25.3 3382092-3382390 Insertion   TTC15
  187 + - - - - + + - 13q12.13 26098258-26098437 Base change, insertion   WASF3
AAGCTTCAGGAAAGTCCACTAGCAAAAAGCTT 197 + + + + + + + - 9p13.3 33972115-33972294 Insertion   UBAP2
  112 + - - - - - - - 9p13.3 33972115-33972294 Insertion   UBAP2
  170 + - - - - - - - 9p13.3 33972115-33972294 Insertion   UBAP2
AAGCTTTAATGACTGAGGGGTTCTCAAAGCTT 1147 + + + - + - + - 6q25.3 157931989-157933131 Base change   ZDHHC14
AAGCTTTGAGAACCCCTCAGTCATTAAAGCTT 1134 + + - - - - + - 6q25.3 157931989-157933131 Base change   ZDHHC14
AAGCTTGCACAAGGGGCCCCTTGTGCAAGCTT 691 + - - - - - - - 4p16.3 2372796-2373473 Insertion   ZFYVE28
B. Sequences only present in CLL genome              
AAGCTTGATATCGTGATCACCTTAAGAAGCTT 332 - + + - - - - - - - - - -
AAGCTTAGATAGAGCGCAGTCAACTGAAGCTT 107 + + + + + + + + - - - - -
AAGCTTCCGGTCGGCTTCGCAGTAGAAAGCTT 159 + + + + - + - - - - - - -
AAGCTTCTCATCCTTCACCTTGGTCGAAGCTT 182*** + - - - - - - - - - - - -
  540 - + - - - - + + - - - - -
  362 - - - - - - + + - - - - -
AAGCTTGAAAAAGGTTCAGGCAAACTAAGCTT 84 + - - - - - - - - - - - -
AAGCTTGCTGAACGCACCTGCGTGGAAAGCTT 923 - - + - - + - + - - - - -
AAGCTTGGCGTCAATCCACACCAAAGAAGCTT 347 - + + - - - - + - - - - -
AAGCTTTCTTGATAAGGCTCCTACGCAAGCTT 250 - + - - - - - + - - - - -
  1. *A full-length sequence must be detected in at least one of the two CLL sampes used in ditag collection, or at least in one other CLL samples.
  2. ** Sample #1 and 2 were used for ditag collection.
  3. ***tag1 part map to chr1:56672307-56672331