Skip to main content

Advertisement

Table 3 Aberrations in the intergenic region

From: Evidences showing wide presence of small genomic aberrations in chronic lymphocytic leukemia

Ditag FullL-length (bp) CLL sample chr. Location Aberration Nearby genes
   1 2 3 4 5 6 7 8     Upstream Distance (bp) Downstream Distance (bp)
AAGCTTACTTTCTCGGTTCCATTACTAAGCTT 614 - - + - - + + - 5q35.1 169443856-169444467 Base change DOCK2 27,836 FOXI1 21,028
AAGCTTAGCCGGGCATCCTCTTTCCTAAGCTT 427 - - - - - - + + 17q25.1 68688801-68689216 Base change SSTR2 16,046 COG1 11,552
  398 - + + - - - - - 15q26.1 88110782-88111168 Insertion, base change MESP1 16,678 MESP2 9,425
AAGCTTAGTTTGGCTGCATGAGACTGAAGCTT 737 - - + - - - - + 16q23.1 74682385-74683114 Base change     
AAGCTTATGATGATCCCCTGAGCTAAAAGCTT 358 + - - - - - - - 1q23.3 162264795-162265148 Insertion, base change     
  264 + - - - - - - - 5p15.33 2449552-2449774 Insertion     
AAGCTTCAACGATAGTTCATCATCATAAGCTT 265 - + + - - - - - 16p13.3 808762-808956 Base change PRR25 4,900 LMF1 34,679
AAGCTTCAATAGCCGAAGCCAAACTAAAGCTT 556 + + - - + + + - 12q15 66234005-66234554 Base change    DYRK2 94,467
AAGCTTCACTCAGTCATATGGCATGGAAGCTT 130 - - - - - + + - 10q26.3 133154300-133154419 Insertion     
AAGCTTCACTGCAGCTATAACACTGCAAGCTT 920 + + + + + + - + 20p11.1 26157494-26158252 Insertion, base change MIR663 20,580   
AAGCTTCCTCTGTACTCACATTAACGAAGCTT 892 - + + - - + + - 9q12 67914079-67914963 Base change     
AAGCTTGAAATAAGTGCTGCATCCTGAAGCTT 606 + - - - - - - - 1q41 220652161-220652760 Insertion, base change     
  252 - - + - - - - + 20q13.13 46025615-46025861 Base change     
AAGCTTGACTCATTGCGTCTTATTCTAAGCTT 1060 + - - - - - - - 9q22.31 94477651-94478404 Insertion IPPK 5,283 BICD2 35,062
AAGCTTGCACAAGGGGCCCCTTGTGCAAGCTT 606 + - - - - - - - 2q35 220216964-220217558 Insertion SLC4A3 16,038   
AAGCTTGCAGAAGGGGAGCCAGGGTGAAGCTT 553 - - - + - - - + 11q23.2 115071517-115072057 Insertion     
AAGCTTGCTGAACGCACCTGCGTGGAAAGCTT 758 - - - + + - - - 13q12.3 30403963-30404714 Insertion, base change C13orf33 25,635 C13orf26 120
  602 + + + - + - - + 1q42.13 227318140-227318732 Insertion     
AAGCTTGGAGCCCTAGCCACAATTGTAAGCTT 1453 - + - - + + + - 13q21.33 70285628-70287080 Base change     
AAGCTTGGCCAGAGACAGGCATCATGAAGCTT 900 + - + + - + - + 6q23.2 135162469-135163363 Base change     
AAGCTTTCACTTCATTGGAGTCAGTGAAGCTT 322 + + + - + + + - 13q14.12 44367511-44367832 Base change    NUFIP1 43,552
AAGCTTTCCTAGGGAGCTGGGTGGTGAAGCTT 290 - - + - - - + - 2q21.2 132742087-132742356 Insertion NCRNA00164MIR663B 10,075; 10,964   
  120 + - - - - - - - 4p15.33 14280120-14280230 Insertion, base change     
AAGCTTTCCTTTTCCTTCTGCTCTTAAAGCTT 1071 + - + - - + - - 6q27 164534304-164535365 Base change     
AAGCTTTGCATTGGCAGAAGCCACCAAAGCTT 1039 - + - - - - + - 9q12 69920049-69921093 Base change     
AAGCTTTTAAGGGATCATGCCTCTCCAAGCTT 1534 + - + - + + + - 1q21.2 148015439-148016961 Base change    FCGR1A 3,951
AAGCTTACCCTCTGGACGCCTGTATGAAGCTT 185 + - - - - - - - 9q22.33 100893873-100893975 Insertion    TGFBR1 13,258