Skip to main content

Advertisement

Table 2 PCR primers used for amplification of virulence genes

From: Analysis of Escherichia coli O157 clinical isolates by multilocus sequence typing

Target gene Primer designation Primer sequence (5'-3') Amplicon size (bp) Reference
stx1 stx1F ATAAATCGCCATTCGTTGACTAC 180 (26)
  stx1R AGAACGCCCACTGAGATCATC   
stx2 stx2F GGCACTGTCTGAAACTGCTCC 255  
  stx2R TCGCCAGTTATCTGACATTCTG   
eaeA eaeAF GACCCGGCACAAGCATAAGC 384  
  eaeAR CCACCTGCAGCAACAAGAGG   
hlyA hlyAF GCATCATCAAGCGTACGTTCC 534  
  hlyAR AATGAGCCAAGCTGGTTAAGCT   
bfpA bfpA AATGGTGCTTGCGCTTGCTGC 326 (9)
  bfpR GCCGCTTTATCCAACCTGGTA