Skip to main content

Table 1 Specificity of primer and probes sets used in different HIV/AIDS and other disease association studies of CCL3L-related CNVs and mRNA expression.

From: Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

# Primer/Probe Sequences
5'-3' Sequence*
References Specificity
   HIV/AIDS Other diseases  
CCL3L_PP1 F: TCTCCACAGCTTCCTAACCAAGA [3, 4], [6]a CCL3L1
  R: CTGGACCCACTCCTCACTGG [5, 9], [7]b CCL3L3
  P: AGGCCGGCAGGTCTGTGCTGA [10, 17], [8]c  
   [22, 23], [21]d  
   [24, 25] [32]e  
   [26, 27],   
   [28, 29],   
   [30, 31]   
CCL3L_PP2 F: TTCTGGACCCACTCCTCACT [12]   CCL3L1
  R: CTTCTCCACAGCTTCCTAACCA    CCL3L3
  P: FAM-CTGCCGGCCTCTCT    
CCL3L_PP3 F: TGCCTATCTCCGTCTAGAGAGCTT [13]   CCL3L1
  R: AGAAGGAGGCAGCAGGACACT [33]   CCL3L2
  P: FAM-TGACTCCAGGCAAGGG-MGB    CCL3L3
CCL3L_PP4 F: GGGTATGACTTCTTGAACCGACAAA [1]   CCL3L1
  R: GGTTCTCTGTTTCTCTATGTGATCCA    CCL3L3
  P: 6FAM-CATGAAGAGAGCTAAGAGAAC-MGBNFQ    
mRNA expression     
CCL3L_PP5 F: TCTGCAACCAGGTCCTCTCT   [34]f CCL3L1
  R: TTTCTGGACCCACTCCTCAC    CCL3L3
CCL3L_PP6 F:AGCCCTGAACAAAGCATCTG   [35]g CCL3L1
  R:TGAGAGTTCCCCCTGTCCCCT    CCL3L3
Non-Human     
  F: CCAGTGCTTAACCTTCCTCC    
CCL3L_PP7 R: TCAGGCACTCAGCTCCAGGT [11]   
  P: AGGCCGGCAGGTCTGTGCTGACC    
  1. * F = forward primer, R = Reverse primer, P = probe a SLE; bRheumatoid arthritis; cKawasaki disease;d type 1 diabetes mellitus; e hepatitis C; fHuman glioblastoma; gDendritic cells exposed to contact allergens and irritants