Figure 3From: An insight into the suspected HbA2' cases detected by high performance liquid chromatography in PakistanGene Sequencing. DNA sequence derived from a healthy control (upper) and from a patient with S window peak (lower). The sequencing chromatogram shows the same sequence in both individuals [GCCCTGTGGGGCAAAGTGAA] with the arrows indicating the peaks where HbA2' mutation was expected.Back to article page