Skip to main content

Table 1 Primers used for detection

From: Occurrence of genes of putative fibrinogen binding proteins and hemolysins, as well as of their phenotypic correlates in isolates of S. lugdunensis of different origins

Gene/locus-tag Name Sequence 5' 3' Size (bp) Primer
fbl fbl_check_F CGTATTATCCCAAGTAGCAACC 404 This study
  fbl_check_R CTTCATCGATTGTCCCAGTAGC   
SLGD_01696 FbpA_F GAGATTACTGGACAACAAACG 558 This study
  FbpA_R GTATTGTGACGTCGTTTCCTG   
SLGD_00006 betahemolysin_F TGGTCAAGGTACAGAAGGTTGGCA 449 This study
  betahemolysin_R TATCCCAACTATACGCGTTGCCCT   
SLGD_00847 hemolysinIII_F TAATGCTGTTTCGCACGGAGTTGC 407 This study
  hemolysinIII_R GACGCCTACCCATCCCATTACAA   
SLUSH-cluster slush_donvito_F TTTCGTCTTTGCACACACATTTCCA 977 This study
  slush_donvito_R ACAGCACAAAGCCTTAACTATCTCA   
SLGD_02429 stlu_vwbl_F TGGCGGGATGATTTGGACGGG 858 This study
vwbl stlu_vwbl_R TCGCCTTCTTGCCCTGATGGT   
  1. The previously published fibrinogen binding protein gene (fbl) sequences [8, 9], the von Willebrand factor binding protein precursor gene (vwbl) sequences (AY530288) [18] and SLGD_02429 [13], the putative fibrinogen/fibronectin binding protein (FbpA homologue SLGD_01696) gene sequence [13], the S. lugdunensis synergistic hemolysin (SLUSH) gene sequence (U73444.1) [11], the S. lugdunensis putative beta-hemolysin (SLGD_00006) gene sequence [11] and the S. lugdunensis putative hemolysin III (SLGD_00847) gene sequence [11] were used to design primer pairs (This study).