Skip to main content

Table 2 Primer information of reference genes for qRT-PCR

From: Selection of reference genes for normalization of quantitative real-time PCR in organ culture of the rat and rabbit intervertebral disc

  Sprague-Dawley rat New Zealand White Rabbit
  Forward (5'-3')
Reverse (5'-3')
Product size (bp) [Ref] Forward (5'-3')
Reverse (5'-3')
Product size (bp) [Ref]
Actb AGGCCAACCGTGAAAAGATG
ACCAGAGGCATACAGGGACAA
101 [33] CTGGAACGGTGAAGGTGACA CGGCCACATTGCAGAACTTT 73 [D]
GAPDH GCAAGAGAGAGGCCCTCAG
TGTGAGGGAGATGCTCAGTG
74 [18] GGGTGGTGGACCTCATGGT
CGGTGGTTTGAGGGCTCTTA
58 [D]
18S rRNA ACGGACCAGAGCGAAAGCAT
TGTCAATCCTGTCCGTGTCC
310 [19] TCGGCATTCGAACGTATGC
ACCCGTGGTCACCATGGTA
56 [D]
CycA TATCTGCACTGCCAAGACTGAGTG
CTTCTTGCTGGTCTTGCCATTCC
126 [20] CCAACGGCTCCCAGTTCTT
ACGTGCTTGCCGTCCAA
61 [D]
Hprt1 TGTTTGTGTCATCAGCGAAAGTG
ATTCAACTTGCCGCTGTCTTTTA
66 [D] GCAGACCTTGCTTTCCTTGGT
GCAGGCTTGCGACCTTGAC
63 [D]
Ywhaz TTGAGCAGAAGACGGAAGGT
GAAGCATTGGGGATCAAGAA
136 [19] GGTCTGGCCCTTAACTTCTCTGTGTTCTA
GCGTGCTGTCTTTGTATGATTCTTCACTT
142 [28]
Pgk1 ATGCAAAGACTGGCCAAGCTAC
AGCCACAGCCTCAGCATATTTC
104 [20] TGTTGGTCGGGCGAAGCAG
CAGTGTCTCCACCGCCGATG
149 [28]
  1. [D] designed primer