Skip to main content

Table 2 Primer oligonucleotides designed and used to generate or amplify cDNA from cyanobacterial cell cultures after nitrogen depletion

From: Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

Primers Sequence 5'-3' Product size
N. punctiforme primers   
hupS forward ATTATGGCTACAAGGTGGTG 215 bp
hupS reverse CAACACTGCCTTCAAATACC  
nifD forward CCCAATGTGAAGATGAACCT 201 bp
nifD reverse GCTGATACTTGGCGATAACT  
rnpb forward AAGCAATAGCAACCATACAGA 198 bp
rnpb reverse AATTGATCTGGCGGTATCTT  
23S forward GAAACAGCCCAGACCACC 197 bp
23S reverse AGTGAGCTATTACGCACTC  
hypC forward AATCCCCGGACAAATTATAG 128 bp
hypC reverse ATGTTTCTGCTGCTTCTTGT  
hypF forward TTAAAACAGAAATTGTCCCT 216 bp
hypF reverse CAACATCGTGGTATTCCTTT  
Npun_0363 forward TATCATCAAGGACGGCTATT 197 bp
Npun_0363 reverse TCTCCCCAAAAAGCGATGTC  
Npun_0364 forward AACGGTGTGTAGCAGTAGG 179 bp
Npun_0364 reverse TGGTGGTTTTGGTGGTTTG  
Npun_0365 forward GGTTATCTGCCAAGTTATTT 190 bp
Npun_0365 reverse TTGAAGAGAAACGGCATAAT  
Npun_0366 forward TTAACAACGCCAAATCTGAT 220 bp
Npun_0366 reverse CTAAGAAGATGGCAGGAATT  
Npun_0367 forward AGATAGCACAGGGTTTTCAA 219 bp
Npun_0367 reverse AAATCGGTAATGCCTCTTCA  
Nostoc PCC 7120 primers   
hupS forward TTGTTCAGGCAACACCATGT 154 bp
hupS reverse GCCTAAGATGCAATCCCAAA  
23S forward GCTAAGCGATGTACCGAAGC 199 bp
23S reverse TAACCCAGAGTGGACGAACC  
hypC forward GGAATCCCCGGACAAATTAC 200 bp
hypC reverse GTTTCGGCTGCTTCTTGTTC  
hypF forward GTGTCCCGAATGTGAGGACT 239 bp
hypF reverse GCGTTGCATCACAAGCTAAA  
asr0389 forward ATTTCTGATCAATATGGTCA 202 bp
asr0389 reverse CCCAGACCCAAAACAATAGC  
asr0390 forward CGGCGAGGTTATTTTTGAAG 196 bp
asr0390 reverse TCTTTGAGAAGAAATGGCATGA  
alr0391 forward TTGGCGAGGATAACCGATAG 218 bp
alr0391 reverse CTGGGGTGGTCAATCAAGTT  
alr0392 forward CAAGCTGCTTTGGAAGAGGT 203 bp
alr0392 reverse ACCGCAATCACCGTCACAAT  
alr0393 forward GGGACAGAATGCTAAGGGTA 200 bp
alr0393 reverse CCCGATTTGGTTCATTCTCC  
alr0394 forward CTTTGTTACAGAAGGGTGAA 213 bp
alr0394 reverse CAGCAGGACTAACTAATAAC  
RT primers N. punctiforme   
gsphypF TCGGATTTTCTTGACGAAGG -
gspNpun_R0363 TTCGATTATTTCCAGAATCAGC -
gspNpun_R0364 ATCAGGCACGGTTAAGCATT -
  1. Primers to amplify cDNA, generated with random primers, from cultures and isolated heterocysts of Nostoc punctiforme ATCC 29133 and cultures of Nostoc sp. strain PCC 7120 are shown as well as gene specific primers for generating cDNA from cultures of Nostoc punctiforme ATCC. Sizes of the resulting PCR product are shown in base pairs (bp). cDNA with gene specific primers were generated through reverse transcriptase reactions (RT).