Skip to main content

Table 3 Primer oligonucleotides designed and used to locate novel transcription start points in Nostoc punctiforme ATCC 29133 and to amplify DNA probes for DNA affinity assay and electrophoretic mobility shift assay (EMSA) from N. punctiforme and Nostoc sp. strain PCC 7120 genomic DNA

From: Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

Primers Sequence 5'-3' Product size Biotinylated
5'primer1 0367 GGGGGTAATCCTCCCAAGTA - no
5'primer2 0367 TCACCACACATCTCGTAGGC - no
5'primer3 0367 TGCTGGGGGTCATAACTCTG - no
N. punctiforme F-bio TTACGCATCTCATCACGGGCCA   yes
N. punctiforme R ACAATACAAAAACACCTAGCCC 751 bp no
N. 7120 F-bio TGGCTATTAGTTTGTATATTGTT   yes
N. 7120 R TCGCTATTACGTTCCTCTCT 500 bp no
EMSA PhupS F TTCTAAAATTCTAGGGGGAAATTG   no
EMSA PhupS R GGGCTAGGTGTTTTTGTATTGT 558 bp no
EMSA hupL F CGCCATTATGAGGAAGCTGT   no
EMSA hupL R CGGTCTTCATCCAACCAATC 308bp/1350 bp no
  1. Sizes of the resulting PCR products are shown in base pairs (bp)