Skip to main content

Table 1 List of primers

From: Reproducible gene targeting in recalcitrant Escherichia coli isolates

Primer Sequence (5' - 3')
SeqLA1 CTCTCGCGTTAACGCTAGCATGGAT
SeqLB GTAACATCAGAGATTTTGAGACAC
P1 GTGTAGGCTGGAGCTGCTTC
P2 CATATGAATATCCTCCTTAG
AttB1LrhA GGGGACAAGTTTGTACAAAAAAGCAGGCT TACGGCAGATGGACGCCACATCGATT
LrhAPmeI-1 AGTATGAGCCGCCAGTAAGTGATAATATATGGTTTAAACTCGACGGACGATAGATAATT
LrhAPmeI-2 ATTGTCTCAGGAATTATCTATCGTCCGTCGAGTTTAAACCATATATTATCACTTACTGGCGGCTCA
AttB2LrhA GGGGACCACTTTGTACAAGAAAGCTGGGT CTGCTCTTGATGCCGCCTCACCATT
LrhA5 CAGTGATGAGCGATGACTTCAGTG
LrhA6 TAGAAGATTACTTTGCCTAACATA
AttB1Lac GGGGACAAGTTTGTACAAAAAAGCAGGCT TACTACGGCAATGCACTCCTATAA
LacPmeI-1 TAACAATTTCACAGGATACAGCTATGGTTTAAACATAAGCAAAATTGCCTGATGCGCTCCGCTT
LacPmeI-2 AAGCGGAGCGCATCAGGCAATTTTGCTTATGTTTAAACCATAGCTGTATCCTGTGTGAAATTGTTA
AttB2Lac GGGGACCACTTTGTACAAGAAAGCTGGGT ATAAATATCTC ACACGCAATCAAATTCA
LacZYA-1 TTGTTGGGGCGATTCCGCATTTTGAATTTA
LacZYA-2 GTCAGTGGGCTGATCATTAACTAT
AttB1Type1 GGGGACAAGTTTGTACAAAAAAGCAGGCT AT CTCCAGGAAATACACAGTCTGAAA
Type1PmeI-1 TACCTGCATTAGCAATGCCCTGTGA TTTCTGTTTAAACCATCGTTTTCCCTTATAATTACAGACGCGCACTA
Type1PmeI-2 TAGTG CGCGTCTGTAATTATAAGGGAAAACGATGGTTTAAACAGAAATCACAGGGCATTGCTAATGCAGGTA
AttB2Type1 GGGGACCACTTTGTACAAGAAAGCTGGGT GTACCAGCG CCAGGTCTGTTCCATGATTT
Type1-1 GAAATATGTTTCCTGGTTTTTGGCTTGTAA
Type1-2 ACGACAGACCACACCAGGCCTGCGTCTT
Type1DW1 TATTGCTAACCCAGCACAGCTAGTGCGCGTCTGTAATTATAAGGGAAAACG TTGAGCGATTGTGTAGGCTGGAGCTGCTTC
Type1DW2 GTTTTAGCTTCAGGTAATATTGCGTACCTGCATTAGCAATGCCCTGTGATTTCT TTAGCCATGGTCCATATGAATATCCTCCTTAG
LrhADW1 GTGTGCACAGCATTAACCAGCTCAGTATGAGCCGCCAGTAAGTGATAATA TGTGTAGGCTGGAGCTGCTTC
LrhADW2 CAGCGGCTCGTTTTTTACACTATTGTCTCAGGAATTATCTATCGTCCGTC CATATGAATATCCTCCTTAG
LacZDW1 GTATGTTGTGTGAAATTGTGAGCGAATAACAATTTCACACAGGATACAGCT TTGAGCGATTGTGTAGGCTGGAGCTGCTTC
LacZDW2 TGAAATTGTAGGCCTGATAAGCGGAGCGCATCAGGCAATTTTGCTTATTTA TTAGCCATGGTCCATATGAATATCCTCCTTAG
Type1DWL1 CGTAAGCTGACGAATCAGCAGGAATAATCGCTAGGGACCTAAGAATTAGCATGATAATAGCCACTAAGAAATTACTGCGCTCCATGTGTAGGCTGGAGCTGCTTC
Type1DWL2 TTATCTGGCCTACAAAGGGCTAACGTGCAGGTTTTTAGCTTCAGGTAATATTGCGTACCAGCATTAGCAATGTCCTGTGATTTCTCATATGAATATCCTCCTTAG
LrhADWL1 GGGAGGCACATTACAAATGGAATTGCTTGTTTGTGTGTGCACAGCATTAACCAGCTCAGTATGACCCGCCAGTAAGTGATAATATGTGTAGGCTGGAGCTGCTTC
LrhADWL2 CTAAAAAAAAGCCGCTGGGGTTTAAAACACCCCCAGCGGCTCGTTTTTTACACTATTGTCTCAGGAATTATCTATCGTCCGTCGACCATATGAATATCCTCCTTAG
LacZDWL1 TTAGGCACCCCAGTCTTTAC ACTCTATGTG TCCGGCTCGT ATGTTGTGTG AAATTGTGAGCGAATAACAATTTCACACAG GATACAGCTTTGAGCGATT GTGTAGGCTG GAGCTGCTTC
LacZDWL2 GCGGCGTGAACACCTTATCC GGCCTACGTA GATCTCTGAA ATTGTAGGCC TGATAAGCGG AGCGCATCAGGCAATTTTGC TTATTTATTAGCCATGGTCCATA TGAATATCCT CCTTAG
  1. The AttB1 and AttB2 sites are underlined. P1 and P2 sites are italicized.