Skip to main content

Table 1 Primer pairs used to amplify the 3 target genes tilled in both EMS-mutant populations

From: Towards a TILLING platform for functional genomics in Piel de Sapo melons

Gene Forward (*LabelledIRD700) Reverse (*LabelledIRD800)
Cm-eIF4E
1st amplicon
GACTCAAACGCCTAACAGAAAATC CTATCTCACCAAGTTTCCTAAATT
  *GAGGGCGGTGCCATTCTTCTTCGG *TCCCTAAATCGAACCAAGAAACGCC
Cm-eIF4E
2nd amplicon
TTGTTTCGTGTTGACATGTCCATC AGCATGCATTTCACCTCATTGGCT
  *TGCTTGGCTGTTAATTTATCTCTGC *GTCAAGTACAGAACAAGAATCTGAG
Cm-eIF(iso)4E GATCGATAATTTCCCTTTTC TGACAGGCTTAAGCACTATG
  *ACCCCAATTCATTCTAGGG *TGTGCAAGCGCAACAAGGTAC
Cm-PDS CAATGGGATGCTTAGATCAAC TCCTTCCAAAATTACCCTAG
  *GGATTTCTCGGAGTGACTCGG *GCTCTCGAGCAACTAGCACT
  1. Nested PCR was used in all cases with labeled primers in the second PCR.