Skip to main content

Table 1 Primers used for cDNA synthesis, amplification, and sequencing

From: The MC1R gene in the guppy (Poecilia reticulata): Genotypic and phenotypic polymorphisms

Primer Sequence (5'-3')
PrMc1r-F1 CAAGAACAGSAATCTTCATTCRCCCATGTA
PrMc1r-F2 CCATCTTTTACGCRCTSCGGTACCACAG
PrMc1r-R1 CTGYGGTARGCGTADATGAGMGGGTC
PrMc1r-R2 AGRAAGAAVGGGCCCCAGCAGAG
PrMc1r-Fp1 TCTTCCCGTGGACTGATGAAACTTA
PrMc1r-Fp2 CAGATCCGCATCCGCAGGAGCTTTTC
PrMc1r-Rp1 CACGTCGACCTAATTTGCCTCAATTT
PrMc1r-Rp2 GGTCCGCGGCGATGGTGCACAGGAAGG