Skip to main content

Table 1 RT-PCR primers used in this study

From: Unveiling novel genes upregulated by both rhBMP2 and rhBMP7 during early osteoblastic transdifferentiation of C2C12 cells

Gene Forward Reverse
mG3PDH GATGCCCCCATGTTTGTGAT GGTCATGAGCCCTTCCACAAT
mHMBS GCGGAAGAAAACGGCTCAA TCCCGTGGTGGACATAGCA
mHPRT GTCCCAGCGTCGTGATTAGC TCATGACATCTCGAGCAAGTCTTT
Runx2 ACCGAGACCAACCGAGTCAT CTCGGATCCCAAAAGAAGCTT
Dlx1 GTCTGTGCGCCGAAGTCAA GCCCGGAAGAAGACCATTC
Dlx2 CAGCGGCCTCAACAATGTCT ATTCGGATTTCAGGCTCAAGGT
Dlx5 GCCTCTCTAGGACTGACGCAAA TGGTGACTGTGGCGAGTTACA
Id1 GATGGACTCCAGCCCTTCAG TGGAGAGGGTGAGGCTCTGT
Id2 GGTGGACGACCCGATGAGT GCGATCTGCAGGTCCAAGAT
Id3 GAAATCCTGCAGCGTGTCATAG AAAGCTCCTCTTGTCCTTGGAGAT
Osx TCCCCTTGTCGTCATGGTTAC TTGAATTTGATCCCAGAGAAAGC
Hoxc8 ATGCCCAGCATACACTCTCTTGT ATAAATACCAGAGAAGCACCGTGAA
Fkhr1 CCTTTGCCCCAGATGCCTAT GGGATCAACCGGTGACATAATG
Glis1 AGAAGCCCAACAAGTGCATGTT GGTCGCTGGAGTTGCTGAAG
Glis3 TGCACCTCTTCCATCTTCTCATT TTCCCGTTCTTGTGCATATTCAT
Cfdp1 AAGAAGGGTACATTGAGCGGAAA AGGAGCTCACATTGTCAATAGGATT
Lrp6 ACCAAGGTCCAGGCTCGAA GCATCTTGTCGTACCATCTCCTTT
Dvl1 AAGAGTGACATGAGTGCCATTGTC GAAGCCCTCCACGTGTGTGTA
Ecsit AAGCTGTGGTTCACCCGATTC GGGCAAAGACATCTGGTAGACAGT
Pkcd GTGGTGTTGATTGACGATGATGTAG ACCCCCATTGAGAAACTCCAT
Ltbp2 AGGAGCCAAGAGTTAAAGAAATCTAAAA TTTCCCATAGGATAGATGTGCCTAA
Grn CAATGCCCAATGCCATCTG ACTTCACCTCCTTCACTGGGTATC
BMP1 CCATGTCTCTATTGTACGCGAGAA AAGATGCCCCTGGAGAATGTG
Plod1 AAACGTGCCCACTATCGACAT CGGACGACGAAGGCTAGATC
Postn TTAGCATCTTCCTCAGCCTCCTT GAGCATTTTTATCCCCAATCAGAA
Htra1 AGCTGAGACCTGGAGAATTTGTAGTT TAGCGTCTGTCTGAATGTAGTCCAT
IGFBP-rP10 GCTGCAATCACGGAGTTTGTT GTCTTCTCCGGGCTTTCTACAC