Skip to main content

Table 2 Candidate reference gene PCR primer sequences (5'-3'), amplicon sizes, PCR efficiencies and standard curve regression coefficients

From: Internal control genes for quantitative RT-PCR expression analysis in mouse osteoblasts, osteoclasts and macrophages

Symbol Forward primer Reverse primer Amplicon size (bp) PCR efficiency (E) Regression coefficient (R2)
18S CTTAGAGGGACAAGTGGCG ACGCTGAGCCAGTCAGTGTA 107 95% 0.9947
ACTB CTCTGGCTCCTAGCACCATGAAGA GTAAAACGCAGCTCAGTAACAGTCCG 200 94% 0.9975
B2M CTGCTACGTAACACAGTTCCACCC CATGATGCTTGATCACATGTCTCG 241 96% 0.9986
GAPDH ACAGTCCATGCCATCACTGCC GCCTGCTTCACCACCTTCTTG 266 95% 0.9981
HMBS GAGTCTAGATGGCTCAGATAGCATGC CCTACAGACCAGTTAGCGCACATC 250 94% 0.9962
HPRT1 GAGGAGTCCTGTTGATGTTGCCAG GGCTGGCCTATAGGCTCATAGTGC 173 95% 0.9943