Skip to main content

Table 1 Information on the primers used for real time PCR

From: Reference gene validation for qPCR in rat carotid body during postnatal development

Gene Accession #   Primers Product Size (bp) Efficiency Rate (E)
PPIA NM_017101 F GTCAACCCCACCGTGTTCTTC 133 1.93
   R ATCCTTTCTCCCCAGTGCTCAG   
TBP NM_001004198 F ACCGTGAATCTTGGCTGTAAAC 123 2.06
   R CGCAGTTGTTCGTGGCTCTC   
RPII AB017711 F GGCTCTCCAGATTGCGATGTG 124 1.93
   R CAGGTAACGGCGAATGATGATG   
β-actin NM_031144 F CAGGGTGTGATGGTGGGTATGG 115 2.03
   R AGTTGGTGACAATGCCGTGTTC   
GAPDH NM_017008 F CAAGTTCAACGGCACAGTCAAG 123 1.91
   R ACATACTCAGCACCAGCATCAC   
18s X01117 F CACGGGTGACGGGGAATCAG 105 2.03
   R CGGGTCGGGAGTGGGTAATTTG   
TASK-1 NM_033376 F GCAGAAGCCGCAGGAGTTG 126 2
   R GCCCGCACAGTTGGAGATTTAG   
TASK-2 AM229406 F ACGCCCTCTACCGCTACTTTG 129 2.12
   R GCCGCCTCCTCCTCTTCTTG   
TASK-3 NM_053405 F CGGTGCCTTCCTCAATCTTGTG 144 1.8
   R TGGTGCCTCTTGCGACTCTG   
  1. Nucleotide sequences for the primers, size of PCR products, and PCR amplification efficiency rate of each primer set. All the genes are from rat origin. The real-time PCR efficiency rate (E) in exponential phase was calculated according to the equation: E = 10[-1/slope] [32].