Skip to main content

Table 3 Primers used in the q-RT-PCR analysis of the Hc-AFP defensin genes

From: Four plant defensins from an indigenous South African Brassicaceae species display divergent activities against two test pathogens despite high sequence similarity in the encoding genes

Primer set Sequence 5'→3' Primer Target gene PCR eff.
Helio EF Fw
Helio EF Rv
ATGGGTAAAGAGAAGTTTCACATCAA
GTTGGGTCCTTCTTGTCAACACTC
150 nm
200 nm
H. coronopifolia elongation factor 1α 0.99
Hc-AFP1 Rt Fw
Hc-AFP1 Rt Rv
TCAGGAGTTTGTGGAAACAGTGG
GCAGCCAACATAAACATATTTTGGA
200 nm
150 nm
Hc-AFP1 0.98
Hc-AFP2 Rt Fw
Hc-AFP2 Rt Rv
CGTGTAGGAACCAGTGCATCAAC
TAGGATTTTTCTGGTATGGCCG
150 nm
200 nm
Hc-AFP2 0.99
Hc-AFP3 Rt Fw
Hc-AFP3 Rt Rv
TCAGGAGTTTGTGGAAACACTGA
ATCATTAGAAGCTGCCAACATAAACTAG
150 nm
200 nm
Hc-AFP3 0.97
Hc-AFP4 Rt Fw
Hc-AFP4 Rt Rv
ATGGTGGAAGCTCAGAAGTTGTGT
GCTAGCAGCAAAGATGTTTGTTTG
200 nm
150 nm
Hc-AFP4 0.92