Skip to main content

Advertisement

Table 1 The description of the rose candidate reference genes.

From: Identification of superior reference genes for data normalisation of expression studies via quantitative PCR in hybrid roses (Rosa hybrida)

Gene GenBank Accession   Primer sequence (5'-3') Position Amplicon Efficiency
EF1-α
(elongation factor 1α)
JN399225 F
R
ACACCTCCCACATTGCTGTTA
CTTCAAGAACTTGGGCTCCTT
1055-1075
1129-1149
95 nt 0.98
GAPDH
(glyceraldehyde-3-phosphate dehydrogenase)
JN399220 F
R
TATGACCAGATCAAGGCTGCT
ACCAATGAAGTCGGTTGACAC
769-789
850-870
102 nt 0.97
PP2A
(protein phosphatase 2A)
JN399224 F
R
TGTCACTGCATCAAAGGACAG
GACGAATTGTCTTCTCCACCA
1557-1577
1646-1666
110 nt 0.98
SAND
(SAND-family protein)
JN399228 F
R
GTGTTGAGGAGTTGCCTCTTG
AACCTGTCGGGAGAATCTGTT
830-850
906-926
97 nt 0.98
TIP
(TIP41-like protein)
JN399221 F
R
GAATCCACGGCTGGGAAA
CAGTTCGTGGGTGGAGGAGTT
77-94
121-141
65 nt 0.93
Tubulin JN399223 F
R
GTACATGGCCTGCTGTTTGAT
ATGGTACGCTTGGTCTTGATG
900-920
969-989
90 nt 0.99
UBC
(ubiquitin conjugating protein)
JN399227 F
R
GCCAGAGATTGCCCATATGTA
TCACAGAGTCCTAGCAGCACA
360-380
448-468
109 nt 0.97
  1. The sequences were derived from a collection of 44343 ESTs generated by 454 sequencing of cDNAs from healthy and stressed rose leaves available in the lab. The primer sequences, their positions, the length of their product and their reaction efficiency in quantitative PCR (qPCR) as estimated by the LRE analyser are given.