Skip to main content

Table 1 Description of SSR markers developed for Urochloa humidicola (Rendle) Morrone & Zuloaga

From: New microsatellite markers developed from Urochloa humidicola (Poaceae) and cross amplification in different Urochloa species

       Characteristics in five species* Characteristics in U. humidicola
SSR Locus Genbank accession number Repeat Motif Ta (°C) Predicted product size (pb) Primer Sequences (5'- 3') N° of bands Size range (pb) PIC N° of bands PIC DP
BhUNICAMP028 JF812604 (GT)4GG(GT)3 57 228 TCTTTTGGCTCTGAATGTGCT
TTGATGCCGAATGGAACC
6 195-212 0.7364 5 0.6845 0.9324
BhUNICAMP029 JF812605 (TC)3(TG)8 55 176 AAGGGATATTTGTGTTTCT
TTTTTCAGGATTGCTAAG
7 141-180 0.7363 4 0.6492 0.8708
BhUNICAMP030 JF812606 (AT)3TGC(AT)4 60 133 GGAATATTGTTGCTGAGAGTGG
GCGACGACAGAATAAAAATGAT
3 135-181 0.2211 2 0.1638 0.2123
BhUNICAMP031 JF812607 (GT)7 60 126 AGGATTTAAAGGACCCACCAT
TCCGCTCGGACTGTGATT
3 126-131 0.3749 3 0.3749 0.6554
BhUNICAMP032 JF812608 (GT)7 60 212 GCATATGCAGAGTTTTTGTT
TGACCATTTTTCTTATCTTTCT
10 196-222 0.8305 10 0.8305 0.9292
BhUNICAMP033 JF812609 (TG)5GG(TG)3 60 255 TGAGGTCTTCCGTTCTTGTAGGT
ACGAGGCTGCCCGAGTAATC
5 212-285 0.6965 4 0.6356 0.8246
BhUNICAMP034 JF812610 (GA)20 51 204 TGTAGTGTTGCTGTAGAGTTA
CATTGTTTTGAAGATTTG
3 176-182 0.5894 3 0.5916 0.2800
BhUNICAMP035 JF812611 (AC)4(CA)5CG(CA)3...(CA)5 51 248 GATGCATCTCCCTCCCTTACTC
AGACATTCATCCCGTTTCACAA
15 160-263 0.8767 13 0.8666 0.9784
BhUNICAMP036 JF812612 (TTG)9(TG)6TT(TG)5CG(TG)5 60 265 CGATAGTTAGGCGAGAGTTTTG
TATTGTCGTATGGCAGAGTTCA
9 204-282 0.8127 8 0.8052 0.8800
BhUNICAMP037 JF812613 (TG)8 55 277 CCGTGGAATCCGACAGGTAG
CCGGGAGGAGAGTTAGAAGATG
21 118-302 0.9270 19 0.9238 0.9846
BhUNICAMP038 JF812614 (AG)13 60 294 TCTCTTAAGCGACCAGTA
CAGGAGATAAGTAAAATGAAT
14 286-321 0.8955 14 0.8975 0.9785
BhUNICAMP039 JF812615 (TC)9...(TC)10 55 231 CATACTTGCATTCTTTTGAT
TGTATGAATTTATTGTTTGACT
22 183-263 0.9252 21 0.9254 0.9938
BhUNICAMP040 JF812616 (CTTG)3 60 257 TGTAAGCATATCATTTCGTCTA
ACTGCCCTGTTTTCCTG
2 258-261 0.2772 2 0.2784 0.4092
BhUNICAMP041 JF812617 (TC)3(AAAAT)3 62 178 GCTAGGATGGTGGGCTGTGCT
CGACGTTTCCGGAATGATGTTT
6 173-270 0.4797 3 0.3966 0.5662
BhUNICAMP042 JF812618 (TG)7 60 223 CCGCTGAGCTGTATAGGAAGTT
AAGAGGCGGGACATTTAGGA
6 210-226 0.6465 6 0.6465 0.8400
BhUNICAMP043 JF812619 (GT)3(TG)5GG(TG)4 60 216 TGTGTTTGTGTTCTCTATGTGT
TATGTGATCCAAAAGTGAAGTG
5 212-224 0.697 5 0.7367 0.9046
BhUNICAMP044 JF812620 (CA)11 60 132 TAACACAAGTGCAGGGCGTAAT
TGAACACAGCGACACAAGACAC
17 96-130 0.8913 17 0.8918 0.9815
BhUNICAMP045 JF812621 (AC)11 60 245 ACACCACACCAAATTCTTACCC
TCTCGTTTCATGGCACTGTCTA
14 225-300 0.8956 14 0.8994 0.9600
BhUNICAMP046 JF812622 (TG)10 60 262 ACGCCGCAGCAGTTGGTG
TCAGGACGTGCCGATGGTAAT
22 230-284 0.9268 20 0.9192 0.9877
BhUNICAMP047 JF812623 (TC)20 57 284 TACATGCAGCAACTAAGATA
GCACTAACAAGAAAAGATT
26 211-330 0.9231 23 0.9307 0.9969
BhUNICAMP048 JF812624 (AG)20 57 286 GCACTAAACAAGAAAAGATT
TACATGCAGCAACTAAGATA
29 212-350 0.8864 23 0.9200 0.9754
BhUNICAMP049 JF812625 (AG)3A(AG)4 60 285 GGGCCCGGCACAACAGTAG
AGGCCCACACGCAGAGAACA
8 184-287 0.5597 2 0.3698 0.4277
BhUNICAMP050 JF812626 (TGCG)3 60 236 GTGTGGTTGCAGGACGGATTG
TGAGTGCATGACAGGTGACGAA
7 225-263 0.7144 6 0.7037 0.9692
BhUNICAMP051 JF812627 (AC)17GC(AC)6AT(AG)7 60 294 TAGCAATGCATGGATAAGACT
TGGAGCTCACCCTAAGAAG
1 297 0 1 0 0
BhUNICAMP052 JF812628 (TG)5 60 268 ATAACACGGCCAGAACTA
ATGAACAATCGGGGTAT
12 230-280 0.8663 12 0.8622 0.9446
BhUNICAMP053 JF812629 (CA)12CG(CA)9 60 291 GAGTAAGCTTCTAGGACAGGAT
GCTCAAACAACTCGATAATAAC
18 224-320 0.8887 10 0.8603 0.7692
BhUNICAMP054 JF812630 (TG)9 60 230 CCATATGTGAAGGCTGCGTGAA
GTGGCGGGCTAGTGGCTTATC
15 190-290 0.8262 14 0.8281 0.9385
BhUNICAMP055 JF812631 (TC)7 60 261 GGAAAAAGAAAAGCGGACTGAA
ACGCAAAATAAATGGCAATGGA
12 240-310 0.8829 10 0.8578 0.9538
BhUNICAMP056 JF812632 (TGTT)4 60 239 GCCACAACACGCAAATC
ATGTATGAGGACCCAAGTTATG
4 234-249 0.269 4 0.2841 0.2861
BhUNICAMP057 JF812633 (AG)22 60 219 AGCGACCTCCAGCAACCTT
TTTCCCACTCTTTCCCTCTCAC
21 169-239 0.9091 21 0.9091 0.9846
BhUNICAMP058 JF812634 (TC)18 55 279 CTAAACAGGTAAACAGACAAT
CAAAACGTGAATACATAACA
9 250-340 0.7913 9 0.7913 0.9015
BhUNICAMP059 JF812635 (ATGT)3 55 290 CAATCCATTTTAACAAGAAGTC
GCAACAGTCCGTAGTAAGTATC
5 288-305 0.5747 5 0.5783 0.5538
BhUNICAMP060 JF812636 (TTTTG)3 55 279 AATCCAAAGTCATCCCCACAAT
TTTTTCGGCAACAGACAGGTAA
8 270-290 0.7747 7 0.7721 0.9415
BhUNICAMP061 JF812637 (GT)14 60 165 TGATTCAAAACGCCACGATAGG
GGACCGGAACACTGCTTACGA
22 147-192 0.9139 19 0.9067 0.9846
BhUNICAMP062 JF812638 (CA)8 60 155 CAAACCTCGTGCTCGTG
AGATGGGTTCGGCTGTC
18 139-193 0.8919 15 0.8779 0.9631
BhUNICAMP063 JF812639 (GA)8G(GA)14 60 199 CAAGAAAGCGCGATGAAAAA
GAACACAATGGAGAAGCAG GTC
14 173-230 0.8967 14 0.8967 0.9508
BhUNICAMP064 JF812640 (TC)19 60 175 CCCCTACTTTTATACGACACAT
GAACGAGAGTAGTAGCATTGGT
13 145-180 0.8941 13 0.8941 0.9538
BhUNICAMP065 JF812641 (AATA)3 55 198 ATGTCACGTTATCAGCAGAAG
GGGCCACATCACCTTTT
1 200 0 1 0 0
BhUNICAMP066 JF812641 (TCTT)3 55 218 ATGACAAACTGACCGTATC
TAGCAATTTTCTTTATCAACT
10 217-231 0.7489 9 0.7598 0.8923
BhUNICAMP067 JF812642 (CT)17...(CT)5 60 301 ACCCCCTGTAATTGTTGTCC
GATTCAGATGGTTAGCGTGTTA
15 245-335 0.8961 14 0.8941 0.9354
  1. * Species evaluated: Urochloa humidicola (Rendle) Morrone & Zuloaga, Urochloa brizantha (Hochst. ex A. Rich.) R.D. Webster, Urochloa decumbens (Stapf) R.D. Webster, Urochloa dictyoneura (Figure & De Not.) Veldkamp, Urochloa ruziziensis (R. Germ. & C.M. Evrard) Crins