Skip to main content

Table 3 Primer sequences used for PCR and WISH protocols

From: Ryanodine receptors, a family of intracellular calcium ion channels, are expressed throughout early vertebrate development

Genes (A) PCR Primers (5' to 3') (B) WISH Primers (5' to 3')
ryr1a F AAAGATCATGCCCTCAGCATGC
ryr1a R TTGGAATCTCCGCCTCCGAGTA
ryr1b F CCTCCTCCTGGTTATGCACCATGTTATGAG
ryr1b R TCAATGTGGTTGTGATCAGTGGGAACGGGA
ryr2a F GAAGATGGCGAGAAGAAACCTG ATGTCTGACGCCGGTGAACGAT
ryr2a R TGCAGCATCATTGTTGTCCGTTG CAGCACAAAGTGAACAGTGACGG
ryr2b F TCTAAATTCAGCCACCATGATGTGAGC
ryr2b R TGTTGCTCTCATGTACTCGCCC
ryr3 F AAGGAAAAGAATGAGTCGGGC
ryr3 R CACGCATCTTTTCTTTGGGA