Skip to main content

Table 1 Primer sequences used in reverse transcriptase real-time qPCR

From: Real-time PCR quantification of the canine filaggrin orthologue in the skin of atopic and non-atopic dogs: a pilot study

Gene Forward primer sequence 5' - 3' Reverse primer sequence 5' - 3' Amplicon size (bp)
filaggrin TCAGTTAGGATGGTGAATGTG TCAAAAGACAAATCCAAGCT 96
RPL8 CCATGAATCCTGTGGAGC GTAGAGGGTTTGCCGATG 64
RPS19 CCTTCCTCAAAAAGTCTGGG GTTCTCATCGTAGGGAGCAAG 95