Skip to main content

Table 1 Primer sequences used to amplify and sequence 12.6 Kb of canine PTPN22 in three atopic and three non-atopic WHWTs

From: PTPN22 polymorphisms may indicate a role for this gene in atopic dermatitis in West Highland white terriers

PCR product Forward amplification primer Reverse amplification primer Internal forward sequencing primer Internal reverse sequencing primer Predicted gene region Product size
1 CCTCATCAGGTGCTCTTCGT GGTTTTGCCTCTCTCCCTTC TGAAGTGGAAGAGTCTCAGAGC AGAAAAGGCAGAAGGCCAGT 5'UTR, exon 1 1041
2 GGCTCTGTCCTGAATTGGAG TCTGCCCTTACCAGGACACT - - Exons 2,3 858
3 CCAAATAAGAGGTCGGGGTA CTACTGGGAAAATGGGCAAA AGAAAAGGGAAGGAAGGACA TCTGTCCTTCCTTCCCTTTTC Exons 4,5 863
4 ACCACAGTTGACCTTGGATAA AGATGAAGGCACATCATGGTC - ACATCAAAGGTCCCCTACTCC Exons 6,7 1182
5 CCACTTGAACTGGTGAAGCA ACCAGTCCTTCCACAACCAG - GGATGGAACCCCATATTGAA Exons 8 1172
6 TGCTCTGGGAAGTAGGGATG CAAGGCAAGGGACATAGGAA AATCCACCACAACCAAACCT AGCCCGTATTTCCAACTTCC Exons 9,10 1267
7 CCGAAATGAGGTAGGCAAAC GCCCTGTCACTCACCCTTAT - - Exons 11 483
8 TGGAAACTCACCTCTTTTGTGA TTCTTTGAGAAGGAAAAGGAAGAA CAGAGTGGGAGACAAAAGCA CCAGCTCCTTGGTGTCTCTC Exons 12,13 1296
9 GAAGCAGCAGAAAACCTCCTA ACCCCACATCCTCTAGCACA GATCCCCATTTGCATTGTTC TGGCCCAATTCTTAGGAGTGT Exons 14,15 889
10 GGGTAAAGGATGCGTTTTCA TGGGAGCTATTATGGGAACC - - Exons 16 332
11 TGAGGCTCCAGTTATGGTTCA CAGTCTTGTTCTCAATCTGCTTC AAGTGGGACCTAAATGGAAAAG CCTTTTCCATTTAGGTCCCACT Exons 17,18 747
12 GGATGGGAAAAAGTAGCAAGG TTCTGATACAAAGAGCCATAGCA - - Exon 19 410
13 TTCCCTTTAGTGTTGGGCTTT TTGGCTTTGGCTAGTCACATT - - Exon 20 92
14 GGCTGAATTACCAAAGGTTGT TTCACAAATCCATCGTCAGG TCGCAAAATCTGACTTGTGG GGGAGATGTGCAAGGAATTT Exon 21, 3'UTR 550