Skip to main content

Table 1 Characteristics of 24 polymorphic microsatellite loci in Zatorska geese population

From: Applicability of anatid and galliform microsatellite markers to the genetic diversity studies of domestic geese (Anser anser domesticus) through the genotyping of the endangered zatorska breed

Locus GenBank Accesion No. Source species Repeat motif of sequenced clone Primer sequence (5'-3') Ref. T a N A Allele size range (bp) RS PIC H O H E P HWE Null allele freq. PE PI Chromosome, location (bp) (E-value)
Aal μ1 U63689 Anser albifrons TG F: CATGCGTGTTTAAGGGGTAT
R: TAAGACTTGCGTGAGGAATA
11 55 96 4 81-91 1.29 0.21 0.16 0.23 0.012 0.151 0.203 0.612 No match
APH12 AJ515893 Anas platyrhynchos domesticus (GAAA)4A2 (GAAA)2 F: TTAGTAGCATGTCAGGTTTATT
R: GCTTGTAGACTTCAGAGTTC
22 58 96 2 155-157 1.81 0.35 0.34 0.45 0.033 -0.131 0.265 0.405 Gga2, 130340088 (5.0E-98)
APH13 AJ515894 Anas platyrhynchos domesticus (GA)10 F: CAACGAGTGACAATGATAAAA
R: CAATGATCTCACTCCCAATAG
22 55 96 2 163-165 1.85 0.35 0.36 0.46 0.027 0.133 0.268 0.398 Gga7, 4082663 (9.0E-56)
APH16 AJ515897 Anas platyrhynchos domesticus (CA)7 F: CCTTCTGAACCTTCGTAG
R: AAATATAGACTTTTGTCCTGAA
22 58 96 2 144-148 1.94 0.37 0.38 0.48 0.219 0.086 0.277 0.382 Gga4, 36804087 (7.0E-21)
APH20 AJ515901 Anas platyrhynchos domesticus (CA)9 F: ACCAGCCTAGCAAGCACTGT
R: GAGGCTTTAGGAGAGATTGAAAAA
22 60 96 4 140-150 1.94 0.45 0.48 0.49 0.363 0.006 0.436 0.304 Gga8, 2546006 (3.0E-56)
Bca μ1 AF025889 Branta canadensis (TA)15 (CA)10 F: TGCTTTTTACCCCCAGTGTTCT
R: AGAATCTGCTATATTATTTCCAGCTC
18 61 96 5 115-125 3.81 0.69 0.59 0.74 0.000 0.123 0.677 0.114 Gga12, 4593760 (3.0E-08)
Bca μ5 AF025893 Branta canadensis (CA)9 F: AGTGTTTCTTTCATCTCCACAAGC
R: AGACCACAATCGGACCACATATTC
18 62 96 2 197-201 1.06 0.05 0.06 0.05 1.000 -0.006 0.051 0.895 Gga1, 74604866 (6.0E-40)
Bca μ6 AF025894 Branta canadensis (CA)10 F: TTTAACCCAGTAGCCTATCATGTCA
R: GTCTGAAGATAATGCTGCATGGTT
18 60 96 2 141-149 1.18 0.14 0.15 0.16 0.496 0.023 0.127 0.727 Gga2, 55974019 (3.0E-63)
Bca μ7 AF025895 Branta canadensis (CA)7N5 (CA)7 (TTTA)4 F: TAGTTTCTATTTGCACCCAATGGAG
R: CGGTCCTGTCCTTGTGCTGTAA
18 61 96 2 171-175 1.11 0.10 0.09 0.10 0.225 0.084 0.090 0.812 Gga2, 30816660 (1.0E-14)
Bca μ8 AF025896 Branta canadensis (CA)8 F: CCCAAGACTCACAAAACCAGAAAT
R:ATGAAAGAAGAGTTAAACGTGTGCAA
18 58 96 4 155-159 2.52 0.52 0.47 0.61 0.003 0.132 0.471 0.238 No match
Bca μ9 AF025897 Branta canadensis (CA)9 F: CCCAGTTCCTCTCATTCTCCTT
R: AAACAGGGAGGTGAAAGTGCTT
18 61 96 3 104-116 2.03 0.41 0.48 0.51 0.782 0.023 0.339 0.340 Gga7, 22851442 (4.0E-11)
Bca μ10 AF025898 Branta canadensis (CA)9 F: ATGTAGCCATGAAAATTAAAAAATG
R: CCAGTATTAGCCGAAAAGATGA
18 60 96 2 102-104 1.66 0.32 0.29 0.40 0.008 0.165 0.247 0.441 Gga2, 111179712 (3.0E-09)
CAUD-G007 AY493252 Anas platyrhynchos domesticus (CAG)5 (GCA)5 F: ACTTCTCTTGTAGGCATGTCA
R: CACCTGTTGCTCCTGCTGT
17 61 96 3 116-122 1.32 0.23 0.24 0.25 0.558 0.008 0.217 0.587 No match
CAUD-G012 AY493257 Anas platyrhynchos domesticus (AC)10 F: ATTGCCTTTCAGTGGAGTTTC
R: CGGCTCTAAACACATGAATG
17 57 96 3 203-211 2.11 0.44 0.53 0.53 0.656 0.006 0.372 0.313 GgaU, NW_ 001477064.1 (1.0E-11)
CAUD-G013 AY493258 Anas platyrhynchos domesticus (AC)9 F: ACAATAGATTCCAGATGCTGAA
R: ATGTCTGAGTCCTCGGAGC
17 61 96 2 92-98 1.42 0.25 0.32 0.30 0.726 -0.036 0.205 0.542 Gga13, 14041755 (0.009)
CKW5 AY720919 Anser cygnoides AC F: CAAAGCCCGTCATAGCA
R: AAGTTTCGGTCTGGATTGA
21 57 96 2 236-240 1.03 0.03 0.03 0.03 1.000 -0.002 0.031 0.938 Gga3, 50882942 (2.0E-32)
CKW14 AY720927 Anser cygnoides (CCT)5 F: AACTGATCCGGCAGAAAACTAA
R: ACTTAGCATGCAGCTTCACAAA
9 60 96 2 221-223 1.77 0.34 0.48 0.44 0.348 -0.054 0.260 0.414 Gga17, 4593759 (4.0E-33)
CKW18 AY720929 Anser cygnoides (CAAAA)7 F: AATGTGCTGTGTCACATTCTCC
R: CATCATCCAACGATTCAGACAT
9 57 96 2 246-250 1.76 0.34 0.41 0.43 0.638 0.022 0.259 0.416 Gga4, 52015193 (1.0E-22)
CKW21 - Anser cygnoides (TTA)10 F: CAAGGTAGTCATAAACCCAGAACA
R: ACAAAACTAATGGCAGGAAAC
21 62 96 6 346-375 2.87 0.59 0.45 0.66 0.000 0.193 0.571 0.182 Gga1, 2666911 (2.0E-64)
CKW43 AY790340 Anser cygnoides (CA)11 F: TCCAAGGCTTACTTCCCAAG
R: CAGAAGACAGGCCTGCAAAT
9 62 20(M) 2 129-131 1.84 0.35 0.68 0.46 0.047 -0.215 - - GgaZ, 9308527
        76 (F) 2 129-131 1.94 0.37 0.00 0.49 0.000 0.999 - - (0.008)
CKW47 AY790335 Anser cygnoides (T)8(TG)7 F: AACTTCTGCACCTAAAAACTGTCA
R: TGCTGAGGTAACAGGAATTAAAA
9 62 96 2 213-215 1.13 0.11 0.12 0.11 1.000 -0.022 0.099 0.792 Gga4, 68269490 (4.0E-13)
TTUCG1 U66089 Branta canadensis CA F: CCCTGCTGGTATACCTGA
R: GTGTCTACACAACAGC
25,35 58 96 2 113-115 1.32 0.21 0.28 0.24 0.351 -0.072 0.179 0.605 Gga11, 13347684 (1.0E-11)
TTUCG2 U66090 Branta canadensis GT F: GAGAGCGTTACTCAGCAAA
R: TCACTCTGAGCTGCTACAACA
211, 25,35 55 96 2 112-128 1.92 0.36 0.52 0.48 0.518 -0.037 0.275 0.386 No match
TTUCG5 U66093 Branta canadensis TCTAT F: GGGTGTTTTCCAACTCAG
R: CACTTTCCTTACCTCATCTT
212, 25,35 61 96 7 176-216 2.35 0.55 0.55 0.58 0.242 0.012 0.569 0.209 Gga1, 269486597 (6.0E-04)
  1. Ref., References; Ta, annealing temperature; n, number of individuals genotyped; A, number of alleles; RS, allelic richness; PIC, polymorphism information content; HO observed heterozygosity; HE expected heterozygosity; PHWE, Hardy-Weinberg equilibrium test P-value; PE, probability of exclusion; PI, probability of identity; M, males; F, females.
  2. 1under the name WD136
  3. 2under the name WD206