Skip to main content

Advertisement

Table 1 Primers used for the qPCR amplifications.

From: Quantitative real-time PCR with SYBR Green detection to assess gene duplication in insects: study of gene dosage in Drosophila melanogaster (Diptera) and in Ostrinia nubilalis (Lepidoptera)

Insect Target gene Primer pair Primer name Sequence (5'→3')
D. melanogaster RpS3 s3-1 s3-1 F TCTTTCTTTTCTGCGCACCA
    s3-1 R TCGCATTCATTTTGACGTCG
  BarH1 h1-4 h1-4 F CCAGGACGATCCGTTGACA
    h1-4 R GATCTGATCCTCGTCGTCCG
   h1-5 h1-5 F TCCAGGTGTGAGCGGTACG
    h1-5 R ATTAGCACACGCACACAATCG
  BarH2 h2-4 h2-4 F CAGAACCAAATGGAAGCGTCA
    h2-4 R TCGGCCAGCAGTTCCAAG
   h2-7 h2-7 F GGAGGAACTGGCCCTGGA
    h2-7 R GGAGGGTTGAATTCTCTCGGA
O. nubilalis RpS3 s3-1 s3-1 F GAGCTACTGGGAGAGAAGG
    s3-1 R GATGTTGAAACGCTTCTGGA
   s3-2 s3-2 F GCGTTTCAACATCCCTGAACA
    s3-2 R GGCGACTTTCTCAGCGTACAG
  tpi t1 t1 F GGCGACAAGAATCAAATCAATG
    t1 R AGGACCCTTTTTCAGAGTGTTCAC
  ldh l1 l1 F GAATAAATCGGGCTCGAAGGAC
    l1 R TCACGCGAGACAGCTTCAAA
  cadherin e26 e26F ACGGCAACAACGAGGGTCT
    e26R GAGATGACGTTGCGCGACT
   e28 e28F CGAGCCACACAGAAGACGAC
    e28R TGCTCGCACGGTCTATGATG
  1. The letters F or R at the end of the primer names refer to their respective orientation (F = forward; R = reverse). The qPCR product sizes were 51 base pairs in all reactions except for primer pairs s3-1 and e26 of O. nubilalis, with lengths of 70 and 52 base pairs respectively.