Skip to main content

Table 1 Selected candidate reference genes, primers, and PCR reactions efficiencies

From: Evaluation of suitable reference genes for gene expression studies in porcine alveolar macrophages in response to LPS and LTA

Gene name GenBank accession number Primer sequence Amplicon length (bp) Amplification efficiency (%) aR2 Average Ct of cDNA
       Control LPS LTA Combined
B2M NM_213978.1 F:ACTTTTCACACCGCTCCAGT
R:CGGATGGAACCCAGATACAT
180 89.45 0.992 25.46 24.30 23.58 23.34
BLM NM_001123084.1 F:TCCTCACCTTCTGCATTTCC
R:GTGGTGGCTGAGAATCCTGT
152 93.12 0.993 30.47 28.58 27.54 28.06
GAPDH AF017079.1 F:ACCCAGAAGACTGTGGATGG R:ACGCCTGCTTCACCACCTTC 247 89.45 0.994 36.96 35.59 33.92 34.32
HPRT1 NM_001032376.2 F:AACCTTGCTTTCCTTGGTCA
R:TCAAGGGCATAGCCTACCAC
150 91.88 0.997 29.21 28.16 28.50 27.89
PPIA NM_214353.1 F:CACAAACGGTTCCCAGTTTT
R:TGTCCACAGTCAGCAATGGT
171 91.32 0.997 23.79 22.88 23.38 23.27
RPL4 DQ845176.1 F:AGGAGGCTGTTCTGCTTCTG
R:TCCAGGGATGTTTCTGAAGG
185 90.21 0.993 25.47 24.92 23.57 24.19
SDHA DQ178128.1 F:AGAGCCTCAAGTTCGGGAAG
R:CAGGAGATCCAAGGCAAAAT
149 92.24 0.996 30.35 29.28 28.21 28.11
TBP DQ178129.1 F:ACGTTCGGTTTAGGTTGCAG
R:GCAGCACAGTACGAGCAACT
118 99.43 0.997 31.81 30.59 31.11 30.25
YWHAZ DQ178130.1 F:ATTGGGTCTGGCCCTTAACT
R:GCGTGCTGTCTTTGTATGACTC
146 94.52 0.994 24.50 23.74 23.78 23.23
  1. a R2, correlation coefficient calculated from slope of the standard curve